%PDF-1.5 % 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream x[Y$~o݆}@U]elXl ~Xz ~BBYy2te I_|qH;|p>ALpyr)3xG# hOO?i}w&@OrffDO$U?? K |~t݅BpN:=ǐ~LRo~ɝs:x7IhÞ6 [*dujVH|,E_=$M"NTQ4AEO"uY"J1h=㟟naӺ*F!/ Cvcpm` q nyQ]l7e6 u22-(,uCYUӽaK]z4qR ד~WZW"d$9|z[6=H`b .8a"vfaT~֡;@բ:'Q/d抖mB6 ׺l>О `0)IcZ^'5%3"|4^/FEUA_^{iVwڥ2g~~LK{;cU;^LֆI-B:fkMOoQ&3<\Se=J%mj`e75B<4),eM$e/TҾr脊+YݖQw[ i+U^Ac[ܑE2Ml"oFYK]*I>+tSE;I ŹܭER HgԉurI$3_Ŋ=eӶ:DnS7,q:)=ڃ<\`4G*}mwˈS_ KKVYNșS:zh$Muh9uk=[d,f}h)S6ZDǰ .ԄDef$W$nhj TZ|uEBɖ+ VoR-{ T#/og ldAܖ(vmC'~:9MVshu8zgB9`Mڙ}v[[W;t ɀ cݶT$OBw .X0i!=i$I!W 78jnkd rsw✸08ˑPWY7-jZV qw{*-fKŤR&h+M9clXq]ZWyta1>镊SM")C/ZSYQZB/afn<&}y؍u-k)('nvv"}#_ٝ: ص3P8p5es_.nֹhR:%]8ӦHuڪnzW9~Bf75Ő/CcGj^oelXvs`rWf5<1}y_XŻPP ކ% ,PlYL19\s0sV5˛RZ*uNb:q+oݍ 5-RP#"/:˸/B`cpR?(ʭh称Ԕ*H]*RU9R3_*SX7sc9tknr;Ԃd@)K3d+ʢĀGA!A8YƮTÔ;4Nv: t4฾0kYĮ$)c`e5&nUIXtl[8R݂ [v-+*xoJ^dh~|..fa;pαqLkl}إ*D(ߦP_NTNT*=w~h܊bZ=w-Oj&eJZjey^V5LVtf?ƒD^y% ݜW99q ]װ3̷Õaq}T&W DWh,g[VBI=x^I0SD"{_|.H|Y!. 9sԒy+vʆatڻ(e2CJCM[JgLf>!d4 &FvfNAkhHM3cRFKgֵ"^Ǣ[s7Pr+J+ϭC6=c]ՐB"̫:+`&u(n73q.-MpԔ$v KF[b#>.p+nZDJE o/|TvUStT ee4u iBs!E1nu m0BWC\eD#y.bLҍ1˩dL2?U r㺵;qCp.5vG"ugΥz/`:TPJ9>> PwEV| 7!CX`6#иeb㎍^CY{RG}dp"=yjj^۴Փ|8(JFTݘpS8Uܣ'koFڹ;kA䷊Ѝ Va ZZK/+W|tW YpS(+KJt̂ }! ^£W xPR*tCY ZK+6.gA+#u W?_oz߫/k~_o{Jr|OI)6zR:ȴX,1OVLvuIr}uJ?,[yZj o)`,1T-rus]O.?5gU2vƃYʼ:^O:5 endstream endobj 5 0 obj <> endobj 6 0 obj [ 7 0 R] endobj 7 0 obj <> endobj 8 0 obj <> endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj <> endobj 13 0 obj <> endobj 14 0 obj <> endobj 15 0 obj [ 16 0 R] endobj 16 0 obj <> endobj 17 0 obj <> endobj 18 0 obj <> endobj 19 0 obj <> endobj 20 0 obj <> endobj 21 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 22 0 R/Group<>/Tabs/S/StructParents 1>> endobj 22 0 obj <> stream x @Dn6{B Eb(Iҝjaf =(ҶjjĮ[#(Grgg5Y<앢~> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?\)Bn*dJ:Ҭ,Oʅڬ$Cq ?*/$-3گAo*[z/XZDTJSZV"ſp2jB9`sVf7>]oe]]8OҘʏDzW:/NĩAE5;GHۑښc8ht"Ja?ATެ$ԮUQQN!j_+u~U"Þ)5f83ڀ)mAU]zUcRBl[ATt~U!y"6=Zf/j`CB=W|6Tw*XYK1?*cBb =N=RE3h&?*h4KLP[GvAT" =O =N.(GAP8 `(~T=H) ARzʒ=IʊJ`!ǠAS4=RMG?*i~U%&) ~Tݣ~Tc~T1@ .@7~T$DS`5!.I4 HmzT9AX~Q$h2 L@9A<@~UR>L*qsI"2=SL"(?*X"q@<ʊ{Ҋ`@tU!Zӎ _CR2qUؠ$QS $qk[@j 8#RifZiͱUB֣myG9haScTAp85RB`L<:NS/6]IW$qVڹ.J5Cw,֟orb>Ir R2kWb*-[Pq5SZzk!$ak:oYz"hό ܫt;,Vd~+ѧDblӰ$]m@WEa!"iSTT*5Te/ 5D0,O|SIz pXdrk4$R!'U:ΙϢ*Wj+9?啬uUg@hF=du }Mb57W?7ɾeS *.mb`+(i$O-&%붟} pT.SDqΤM8S-:>Arn11'Gjw?kYlI5 ~$Bvz@GJ߉/E𧊫!\M$gS1)(kXqJ9+L9? >L 9̤EchOuHŠ((>hq@bZ(1EP2-BEYqUPT|žόުz^FOp@ZA]ؙ;+V . A3jMFJVNWG$$g"$(B7C^7ԿķҦig8*8 p@zU?٬4*y'tw{(>m7)L TL9N8?J)[YND*ZT>}ƤcUTKSJxWF:S%SJ@)}?_zlx' d?vVv]^RɦNAMh x%1yNװs% pTyW1%,!B0eS;WTDѾ۸Ymď+ ]#r9)j%P1‚O 9:ҞӸKy:jq*qS,lш<9<ب&\G.9 !i d~P20}zLiÐ?r,$>mSTCc'+hicƜ,`_As'T݄<,ngع#O? qSAsE9\:YJas14`T˧ Fi1?J/Ƥ*@QE.4MR@ )vG^V hcNԂX'f#?7dRh%-%R@ E-(PQE-1W~d.9`|ՕIu8*%px8ָ5c߉C3>4c[e2ZCoT#hnkI0^+"v^L#]޾GegIgC#h~9>*љ3dʦ &JH}4MF-0~Sp~P})i})Zj5VM$NG%Y9dM);\_J]7S[k{_sYGֹ3pNtDfO9\44G&{8cl\,.]0SmA]mtC>ZH4hc6*{_PT[ڨ&OS%$tg)ПG1t'k7t4%\GJBԌ5i nbnуNayJ]ITD\nz]4fQ6JP&hRVWc3IEUZZni3@.>S@1ML1u4^yNpV,!ml%su2-u0SR0(hQ@-%/jJ1KI@ IN)CQRRcV]ݏB?kJPTVZ֓six,D02}_֬iu]\c>e)5s^ qjڮ2}k̖ǦVe iR0"aQNaQLBAJbJ}!"bZx h >)(ƥn}a:GX6}Χtֱs$('ҹf#prKkAd봩bb1ʽAcP(kN:w:Ǎ*]PODLy4 ֊G8=vՋ?\wدOrk6?d;*#Xl 1"u-S͵\]H"q6CBci*sFVp\oC[v0gBGO?VPRu=<'jib .j685du4iXW]-=jHHR8*#IZZW$FތsfT%]b3LIf4š;4Xiz))暋Nx;SO[fyOƔ*1OZ))h))i)h(I@ IKE%'zZ;F\uOPGnZְ'vFP' h0ePI,H=XI6ʆ\:d~f;uGS} u#HFGR-F)Ƥn:)<]`>Xfz1V:̞\QHVcvf7zbGP9?5!ͣN=Gp9OF kIYz|iTɏCQLp>MҝހR-F*EJ)b)"q3T%_u6Xʂ8?ήx~[6aIS9{=5?k_Ԙj'\ws[9g{:c1MF[[YJPÖIv'z V}N rp, w|?Sۊ ~{C5?qǗФ]:_RPrV_ګVO$Z&Fߕ}ȾRCkq,!88$ӿjp剣9hYu"l>3먆hrZ5KmJ]?1(ځG :5ig#F]?ja4Dڧۗ̏yruZOJt|u)/9$B2v޶4UU Y»6qE:5pqsQ\w<^jm4ّD/?ʻa'dyd)^Oa]^`UVQzkv-lч*jJPW3n?-W?WsA2ݽ&\j|G ՛VͮtU8|d/JzzͶ;cN1mx>GjS]—qYM}<gJWo^XQ =qַ$xʣ ;BF| Ixj}'mDW ,m< cLz 5Kue$+f\,%R=0RNs;ɹ$0IqXb=ڭyT+tii)LUO̠#]$t5驗YAX 9֦Vڄqrg$ };[ҽ:jw}N8sje܋e y~+fyk!{ǥWE$Q,N]F>u.T۩8f\liWֺeB;C7t$8lP(,-"uF d~"-B% aS ׊# W`ɯ]=7{.qkȣAcqQNWF~NIsV753ٵs@_istGMBD[b1}:9էp@]in";oǥoNN6f Kڬ,*d;b]\\4Όٸu:%trY2>!k2%!R۝rNGz7'a .Bq#'{t4`Ff`c6>Sؿ *?ZtY׊]ˉc霘dFi '>Aȭ=#pfzcuGY֯_?ެoY)li(4d/ݤ4iHwQjAԪkD "ȩi!i1Lb0h \R▀)ŒR@ ?xӅ!5-yQNuHOO{O+IUh?rJ 8f1ΌYW;A5o"ccIi ~Yƭ΄DT@|us*w%mJrc8]APO'ߠ],I6gwZLq!e<NzgiRednM=;58بԕ8nm .bBJTZ6VI>7*+92'`g][[#T#; ">ѦI$J!{iip 5i5d ⣿7 ?9*ŽLI&4HaԚNde&"36xʎk&a e=tGX d5f8ۥ)IfiU%hڇC;!;@][$wF-Z0?N=Jery*V!L:s=k.؇tfPN{D_B$qUqh\w>ƠyYq>+sLrdcI #'gC? )-sQA$n6-1konhmy2?ֶ/HnOˈ?ĸI{>\Fwu儽r=*}>g@DJ-+ ;+ #Ө9p.P$j@oG-ŭɕ 7=5T $t}G'*WU[[GEq,n09 ꍧlMX M #>Z2iLEc>?Ɵ htգfFSqYq rc,]VƼˢMR:6Ęq^سducny~h!KB6X}ydL9ɮSC<)ɥcn;.2Ud'F@9T pkӉ]B8>ƣ2Op!('yX#}9W3&*PM6r#7tZR]%G$d O~=-$5 rШݼAꟖv_D+dZF[RsJ⎝G=;@mt Zy:hsgڟ9W{bʹ8 tQ=cV&.NZC'5X+;y%4fQy$mǁ+9_ 'Mm ,Nm:y1{`-$1٭a3Ou8;i%ė6>/' k复1ӱ^Ϛܡ}n݌cIWUeZlm^[:le1c^Ebp&5:Ӫ=.J&#wB% })w<}CGd;q$h}(D{''7c4sK;t$Zn is>d.O B}(aa據\R(RR)ER8P7?/VM{/W)vUyk#G^I${Eٌ>~+/?_E+<{<Ka ,~S^bcF~CloB٫$Z=7 nfP#fT!h=J&md r @RjN<ܧi-Ѳ*Y;(Viqa϶#ԏji7GTJSeYāFÐp3XE= $e;6k$-۟gbxۓI`zSe.;KRoa?Հ'8ϥe0Nӟw.!%nl瓚RSȕ8cN#}+f~ZL쩰pzaNNrreA۟j)0')#Q`Y.N=g?JWihR_rAsZCX*o7`[ȤU]ՋN2p*)mVMҬ-*yRzX,qIU|-nA.`$H R?v8_ÿ+x".2uB &o$07| ֐/tlfDӮHETzWYZ2txEbRдX"ܓJ0'br7 ]+̺ o/ ZqHoP@'ĬX i"qrX7'49Ա“r$&R0xva}j𻘬Z_Ot*hҜynCh'S8R6qXj-6O\Iig'tcbOaQV訫&}:նIo;i9@qYZ_\IHI'?έa! 8Ϸatj D}y88353jl`U4[M-Ԧ`:8ՔgdPb)GK4-.-u&@s9۸6 A+%C/eqO_vm0)W,z-+zmԦbOw(5 7*Ȋ^`k+RTc.~e }H8qo-"9pn[hѪӋ{vilvQ]I\`DC{32NSQ5[=;VAXm}4#{LY9u؈qJ5-$m N~U]Pٕ`jaSƭo%̺)p03UXrd-j]EJ[#nMNH )+Xx)E,2&Nzq<0$qGnGM8Kf)AtwZw#dɧZ>n꛹!wǥUԭ?eO\3lykhaCeD6X5k| N=EFZPZY6io(k #KXhlDI.vc^Eg2OucύdLOASKL+$+e o {m$$Rg/㱊-A?Ҵ,G+k$@;OB~_¸ b?/[ aX2GM;}(HJu8ÀM 3豁 @Zb?+}i~ZX;#n5Osq |$8ֱ*G!6宋& E)I.4ңSOll6fG<սA[,7ʣk09F :Y9.w.O_SVhHl\ Gc?FCmọm^,1ֳ\d\$$ȼ}޿Mi2>3> jX~ȼBz,O$wCѤq2p =}rj)Sq٭Jl_Y= d Nz9|Q/V'Ϥj<}~ٞ T~^vדyNL` rC%{M ~\ebUⵂi x$w+.85=>0Os0Ok+XMP;͌qAIFjtKR vl tpW9[46ѫ 7R+`bIܱ.8c`X.9-1NJ钷$4QRV]4?g4p>ǡ[:*($l6; 8HکQIlHSsBy?γ#O4 =6T1ÜEsqh$AXp0B.V$ ~ ttf TtធK AR`} $ V$lX'kn2*(G߹! 3bqMPBr*|]t#[1Gi3Xw|Ly c'=HEr>~ y#7.$ipzE 7ƴn;--  *(RUY':wG!{R91{W#xGQI fUy=({nVwǘ5}:;0n6N+mUWzu녘AZтEI8Ų_<4~ƾ=X0X!/]g:K|\a8l؎}|d?ErN}wʹ_.Z{翐X3iW_x_\3  UXGRwW&Qqvd@/ַS0}맏!_E$3 (;%8iKw9(-2AFzӠ]¢cRez\Wn1+~Pb-a?A\4w7RtIs0z ƻluz)~Zi^:Fۓ>z42p:#RQXݯ"Y Y$8e(=jP\.%ʏ"_lFPvF1M-fB<UrlI<Y3[HeHUE V/:޳f$=GjXlk" 99]Y[O,唓b!AW1B> _[LEĎQ%/ ptZΙO犾)KUV|V] 0=QԏUol{KKvʟ5gT_K!8DPeߦ aZd[h5)I];HϽ]ڛiW Oȧ+Cn{SWWR|%`? )$Um6Ej1Ց9"2B`Y/l\NL%%Dr*XtZt ')-fx{٢ŔqEg}N'D9cښmѡ`Ğ6 {8xqRI芕I{捒\G3G+v)js?Jj Y.V 6hSrUe(@'cɡߩ AWs˦Jpj[{eG,IMݚBH.lLZŽ q4gAMmKh7ȩta~beKs iBp} ]((+!TH-?-^'r~"?@ mxZuT_̉!T`/zKMsHb@9UUﵮl#|UGU]x(<δKkWdMZxN$f-9-5|_3ǚܿY+IM`|]$Cs[Qѕo裊xZEZmod)2?+V2Z]V;$c9Nj);fU97_K)1^}6oz5׏͔WEM,xHߛ¦EhY J)@@w>[{HGV>rT^,<}hI@q@dt⧛[yQcXٕWyBh# 1済T^ٯGEڸc=,UCM݀)y*}~:xTʌTKJbc)$Yd˷=m'b(h,FȾ'MƾR+n1WeP|CjV#%b;/֟! BJqԇZ$fF_3ld\ŀhBSG;To.bNjmR$LyCڰ'k\wU$xvf!Κ%έ% . pۈ k`$!p(Ho0;2r§SE^ϵI|TsAUII=4E*CL 1)O##+cʘ# 9is7OޅGr%1d#o?6iyPjM!Ӕ`i#S@?AV2{vǯMdH=H=F4v4i\Pm>nr o4^Nmak4nHdLvϦxV2o!U3`'vi ʼ;:+( e~m'vH(HԸ]{R?&G+w5mK鵱0Dt/ 3jZuh8ogˑnG3Nk% pqK'UkhR8_r<ZԠMϾ6T]cN~ Qt8ZɏåG^Dɻ|&@Ft\Zݵm9K/3q'/#)򥶞V-!قzX28~HNuHȬ->팟:JI:Rv6{/O2!1^'mb=_i ߏB-mW=bĔLPh8S0Sp.crx<*/9?kl 䓂Nr+ >?|8W*dyWWSACG?S7 Ẕ{ N{fǡ+ =E;k}(?^2=VTZPrzW&'Op6Ҳ|:q7մ8x兽~m(L} Z Q89=. lHe %}A* A\70H<ZЋ\,;ER:cce'IC[[ ]> Rp}-=1Lև]P05^Xg 9*QksH=O%6CݏҀGhjKԱq/JNpCnϰCQD7MN 4[?yGSUԑM.Z҅;8W VPWI@M0)cV#}M#1R |*AQB ”8GҬm Dy?1L ܚiVZ}6N~%$W52"Gz S{&ع=@iLg"9'򦴇ҬR(W_J,}hޣ}i~;{Qp"%^ (AG֬G3.}wWx6Ni jFOl{S@@pϭ!m' Rf 1M94Њ9ZqcUUx$ѰjƜ#p\d;qJք  sD`1RNOKW'֓Qq$& E9ap25qQz$Ҕ8A}(=\r?ޥGRA,',EZ)Y;~ W8?γX5S%)삞39ɏ;FǴ?ʱ"lJp4skftٟL?a)"hV>v o{w|Q?"m5X ~*;PǬ;fFS!ȏ"Atd5ՉT!qَNxfE+mQMKrT })82ier}黤nj˰JM>( J_x\T8$N8\N1ORSg z&,o3TTlPFM<"`ޓ-ӊkEqStSLYR(P.^4m'JУQ^*ǖ2yf}/SE=@΋)vh`OQ+8y4 y#N5g=) FL |8U"!U~M4 M I"rOLaɨ˗8t+2hR1ޫ'4\9Dx-mGl_lHèm-TP:R^·&Wzː<= IrH yoc"ts+y}m_m^ad+7'|<Ǵ3Ysx#:jve{ |yHRPS)>4bp,o4رv$/]NyKayEta)t\C}8fʪ&=)u}i:٢}8ՙCc ALfHNؤgtA.ne=6u ܀JO?tW+Rhir Fu+F)-u Ĉ?rd1<~TKf 4үM]EGP:cTPJF-M1xipHsL!)qhQQ֤Sؤ<7B8iQjx=b4'@FʪF:c vGCR9scB3Ա˙2@4SṪEӬΏhQ >=^v)$2D8u72€xQ{M K)i*adaeqwh,N*x"zOAS[3aEԧbS&}oV#ᙶfVV e=p=iw'Vm2F">*ak;i>DO#jY(2G*-8 q}JROb=?p'J\a($u ڝ?:cKBLfg҈9ùsJ"y5c#HOS3rPWCpkZ\,yi ~uWր:?>hnEc h[8ПʼvCX7,+4QBXJoUxLPx#W;a]_$C`$`O*Z4nQIɬe o R| zq Vf at^5/uCʾ5*sGDjSg-% 2k'n[SfkʈD$maꬖC?Ƶx:HWs%bIqE4SZ\JTK}*AZc@%(yS?7j\RVS+uê* jy@VT&ꮲӱc#4^) 6rk5g9)B;Y#gګak7&0^*\QmX)9&z5=7uEC-T]GgU,n1OE4e㤜gQG:qRH~Z]ԒaEbz!dE>hR.4qSԮ}FFR}Q}N Ihuh8a) ( c9'?8\@.Y5b+@)1k7!z wk4qz՚D5U MYbߌvmgꦆAsQpY $~bUZzoȞZ̲F=ǥ&=qRmH7G ^iz&MF/fOs%ZcnHs5A@jBHHZSiP>BPU94pRUԉ+%s$pW)ֳZ5'f0,0W=zеraE9$wo?ާ]?0^L)Pƶ%~B47QNu#c)PɣtOE?^LuT1| {qݷ4ع}*3<Ѹ!tj&ljMlqOth[[P3q0+X4OkEZhЃfغҮ~2_YH?uy-s:pjgG{ėBKᑦtKoZ|}qW zrr!IUyx@LZr{xZDz,bObs(Qvk>a?Ǐ"4Ivheb$%R, dC=\K%+Oi&ϓ<(,;G $7?0 &S %Mï%|uXy95*릴9/Ŝ:24K<+z *v8ЊFyV$Bsft:5V3L#=qRd# ?9M`lxW{#G##|EMʱ\3UPdU'zS3isiԏHn NRupp }QNnM:YL ,@N< LLh<-j!Uz[[Q5 )@>^|lI$VPpAR(XTFP`TF*{b3|bɓC)SUWЀ2E5`TrtrNhʼEZLJ @S)SǽGxzR֗QK{94ZQ@JqKy4c)1wi@pGQKRB 6* V}:B~M8=Ѵ۵+cD/UI,%195_JShc:S oK2~VM&9P4ULgoҬKLkU1C4U&9(V?SQ;p$]1QvȜde'֑] .Rj`۰7JBUdUUU?0Tt g>]B/]B}*YVH\TS+U_VRS-Z=*zP 6OqL=GMe  u.E ?TMը%*qԑ9YxJjJIhȜSzݿݑxՈA6ef?ʣ_Viot묢_Ӽ&q}EdUiNO/=42 A}>1Q N@I XIdѩTy#N;`'sberNOrk[m=ѰD+';7ta(EYL#͸ե $Wk؟ن˸V$[$7_S˥S ٴٕ_ץh7;,Yri Zmtoe3 GcH֓5˦隡5#AZG0Ӗ m3ȳ\Fr~@yרe~L졿f5-㩡 [Hw*AYqmiͥBMj&Ohꡅe*pi ױʡqҦlcCCi:E܎>ƣ>lQo Foǰk:_ hIAt2q&}ĶۑUvI >̮eЧ,c{QSJǥV&@R(z}*eOIۭFP{SL~Qޘ S ьa܋m6Te#ג!Q:VȆ%'O*neG9bevb){h=WE{Ȥ 1U<NEXv G@ҴԮU$V7- *>Ϳ :t0NxUdeU$.:RQͩu"p'';|3(<`]Iԯ,9>=xs*5ob`jUP sL}))Z=O~t_ZvyyiZ^잸ϥ4{S^RLN;ӑ0?)zJ;d~p#8>&8 o1Ҁ܃{h_ sTOjo |ïn &~f_Lj 75Qf13dTT! RyFEsT}U ʑV`zi,|#P5۶8t٢g<5}*SHe#֣ǐA,4ɿTg,V*zJq%[Oj_³|Ư[!!Ӝ `[RHr =ԛhO)>YXҪy!D NaRSrY>j?xթU7MzibS ey>ss貤A8s~41RiT$l37Tܘ@zTѵVKӡz rj9&Bp[\OzJڍg=k͓!r9]RW5ME??!4ِZٷf*hŽ$.JlЎ> 7!0 q^0sMJos ?pJܟJw9QcM:s78_J} hgng?Լh# #JM~9s׵/@88"QG|P|RʙAhݜ`?QCL x=x 8< éw S|ќ`<Ҏsp h0GҐ4ҘItLT4m8Ǡ{i?-qҎG8ǽ!عdЊq}Ls vs@!=qCCUTWTÝh $fӧ.(|^3z>: n9P28z"K-TE*=,E0LsS]rNsRjHt.ESIr#'[VZ] 4xm$6y֛b[?)iP 46 j1?86[>0$uO 7w})DK3U$o;iXli`Ty&Z{KrqJ_CAiŸT]ߞ9: vhi9J_TnPE:cj]Fd =GkG- g]8^@޵[35J j?DxHf_H9h-5ȳUUHVմ:OSGП>67C:H=?QE̱)+= :=j<C{MlZ}Yn?J(KvhDI- endstream endobj 24 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?FtmI-(bJ0SRS 8"B qҧ~{hӞ)([qXHVQP*I1Q8cLF9>/ugNج6A}%01&_2GLv2#xF˖_Aጫ z8 71 F;wSޟ9XP+. '9/Ӏ`l*ivǸ3 8?f'Oes֋1^632cvw^SLWjFj+USL/o!);zՄ;[ E4[2:S4SADB0XD}*p6j,B=<qȢrTJ\>a8/ ##y%r8EcЊz@)⟾, !$F"FyL,t%xݩT t$%8tc.=H)ԀAR=IQ@ zʝJ@7~Tb?*LASI@ 7~TRb?*BzʟC@zʐ?*v)1@ 4?*ya~Tq@ zʚ@??*i~U%7 #=RL" u@?*EDÚb*?*!ޔS,4 k(s{Z!{]; ԡ­M,0Lq*-fn_\֬Hx).1! sJdfF}GJdЮ- Đ8 6zby_\tNˌelh巍0n³IGr'O2e[( WU<6za1P|zцpP/‸TElNqOCA IY? YT9! !y=n1j0I8RL"UOoZa]aYUF$Җ'F>dI$EntN{ȷưWn-I cf) V"ؘD18#9G7ctyŏ4 m-(( )qK@ E(4xS[>$?*Xҁ;RE&)Eq-P^ X̓H"Aݫ/Yodnkv > (B@ aR:QR\$uqcy dIM eq7w6Jd ʼO:C gOSyPk/u[ );zy8-'r0~*H~5y 4e7S 7S(RbLRibjCM4iOaHȨީMGhMHҙ Ҧ\QTA׃Q5NA5ZRm:56UnvX}+?H(>\#=9x MHs–T)\ԓ3eQ1'R Wf!7_:T,$99׎@.>Q5Իdk󆫋xn%;Nz mN})+>U[vLsHm8/!bibJldrKq@C SqU]^GH` >IO! 6UbdRw ۊ.$Y$J&Qs4w1>]v?@)-ԉSUfL;'۲2^0ʇ g +W6,Wr1Hy"ux!O5F1zNA=G70pyI"8f >Y#-(Id"29իEnA%H>h`.? <()j:E#M:VtTM"s1Os1ar}{U|2n̘5]=F@o{ xlPQ+4$=84dҺǽ6u0( \RK@0(a^(l\ڢҚAc<xu.In5.FQbۈ8q(vȻIEiX}VSSkrb@(NP)s@~ǫ2*>ғJS<>T'zSOƯ#H4P)h!@=N[u&OSPJ?Ա|ưs#LJ2֤V6։GhMl ""oyJq`NG#=Gһ;Ecb7'c8_)TZtLPqIv90\|c'"svEquǢIe9;vkWK o9*Sx_ rGd__Ap-yalΰ@iD:-:Er"anjڴöig]\'QQ.hH48-(.=IVyI -Hu_'-ɫ\JhR 9^ff޵di5)n̍GjV3(٩>NqEFF*R}?ZjG(( lQHmቨ"PJ4v<}[mDHѣ=bGHA|O8.;ұ5oJ[˂$ȍO1IhDΛ6&'Ҝ9%QWt]McT%I,4.6䪎}4dͲ@K\I"2˂9 jL˟&BCe`µ%DDcM*\<@'Uui#D7eL2M|X1$t,E*{Vw"\1A)圳1ҰӱJIQH3mW |_zkiג(>an͵yǭ.vq/Z.nub>l:UIsc( >-nfo-{R &Oi|I?.Fj[v܄>mFBᘉ3 .[J`YweIڣx䓌PP}*[)'1u cN"–$O6 c@ \ i$54P Z)iQE-S]j]3@@vDOb{5Ё\/^|=fK]?&<1fnI.y,rsq *qW#7?XI K,sF> pY$Q~H˩RAXWie!I/VK8=lIX&wǥ$e1j > YT6=q\ǁ.G+PNk5yJ;S1(i@g\1ޣ%d9rZڗcb]߈вC|zVA,q\W;(I8܂ B6oSNA+  (;^X?3u Ь+<]Yi-qڽ.W ib$\7cfdґG=+!@r}]2?=kJ-+'+DS"9ړShRHhv+.dZ'h"'={FhrfO[%b[66Ŕw`bii TsV0N~ ᵲ_/anNBPdɩAkt*,2m^ T9MXլ|bK!m5R)v é'5ak2[8=IM6&d[\jSXFGa\ظV믯t`*49.7F(m#Y7wl.ՉPLݍrb`=ݺ6<9Akss\kqYgt;{jQw*ε?yYG<ˑTy4Ƹ=HƘG̣UĖ0M8zJ }(Ag$i& 1vU[g#s@UgVfaJomRVF1ؤJybAǥGȃg )#DnyŘ֪sIjCmq(C۶AXsMٛFESyn@p|PҲjhl3enxʟ7*υ,/fYXAe9q+p;VicKޓfhD%ܭn2>޵kxbmMLmq!WAy5q)+Cs~$E<~Ӏ 8_⓰>s\3,RW+"%N7e#kӥ? rot)rSx*q+6F6**9 vlAԳkY$q4F@;VoI8B ?(׼X-8cr;5`G }ۑd,YzŶ[nYn ~*08Gx$gNAFߕyi=U2.հvc5bX`pOe8i\K bz*tUzN9&7 3jY{ZѥVxOCZKU-כi֚? ^v98UP>S'E^eIFiP"0r4-[4,`/Z=} [N08l\++jD^SonrT,G Ns=I5rwjj+jIfGOZEf yQ$d  |=*e IIwtaA?)@gƏ"I$|o=JΈs(Z϶LynikyE1!TM * 㩫6km=xG之9ֳ+Nk.fS@H)POcB2K1s>ޛ6.$lGLcVt/w F#/0tkAxW`0 REqvLn}kȇR0Uke6uhF3?η'n4|I)ξHluaKqŠyz-Yu=N$ɉ܎FMBXYdcaՍTӴ-B+MJAa9=Nk tܽƸu;q:'xHdI#n?ǭnq ӶҁK&>uy`b fvGgv9fcOzę<9 egח/JdůûHa3N? +{B diT2:|YX!s"-?펮W期@E6QjIzRP1SrM;TzP0<.G5W_hAZԞt^|QvBfgIҲaݸvNJ:gfPYsGr2HϵXy5.nfM^yPJGJ4L2rxR~M=I7bk&ɷcnQrQvw[ nRw=.OsvV;I8RqVI- e 2 T&ԗrҧ SY+Ķ}s4l/[^kc,4Rl{_jK˅}9|droi#~q$zPjVw7 U 1WQ~}p f0z B !H'?LwX%]H ǽMʬp15IY]<,]VOcv6L`S=-$Rm4&[zc$VcLdi֚{i:PIsjXv6&rmhcڝ9&+$J>RiW K}+xr<)wRbj)ÅV5.xO>0^&"Jseؿ=TUA:*$(64g`4$ <340<ƼMxA~QnTHҕS2;bXfHבQg8, xiEq@]k+BC`F4s1#Ҡ |~54vG0+XLj9;O麫\bLzBEzQINP׵AhWz]|ǁx0 2 ;€HՈLr[)Oqjd}<>@Ү ERR??5q8R^F?MƵK"4wғ!dM)@Q\S!V* qS'vRhREHNU= 7̉r~}NyNN+CB,go&08!\uSn`ҳgpF x֖wƍUpNwNg76nX<] r99X(MUYGpn,=+(]tFʍ Bd%k;U8EPo4(oV6w"`8'ړJUz]:BNP$,(wu mM#M[{G]ŕŷZXӠ$3XNׄ<66xXN#$- n SNC#~ֆVԋUK4F{Rv:m^ma]'᳃T>hۢp"slt{i#,*(x5WM!:m2oZ\wrH[bԼJ~vէ=Vf8wR8w{ѵ)ID^DT@:K{#,Uqiꎚ^*(ۑK[N tZ4hQ(U}2q~SvJSBS! x4N(0S%8Q1@ )i)QZ( QKZLREQE0 Z)h (M@";y7K'%tVc%SNhbztIҬcL\fy@]Sxg ߺM ;āGlv0;FB)5UX=I9%?E2qхH4 <1jЏbUg>b)#߁V|KO?oL4VEexz9mntDNnq>]Nh/n-LӨW!"YV#,G{kRZ#(=KMic%Ct?z=y돾12"HrG Jڔ^]3!.,sw'Uxcd+MB:viIʷ!Vk}˼GZWV\b SvRYxo{.NI;+Z^y5!Ez@?)Q=i@ 8,d+VOï5{L _2-=ק_h7vbPQ\;3j1t8i'xE>&$1vw]ޭNc2. 8QZI܇$~ 4*ȭtQZ5x|~܀%:*Tz I) өҊV8S\TRUi 2p}M Ȭ(ƌ8yKgqHm$rFi0!H),y銳gk.{G"5P?WwF8zGj`Echo!I#*̳ixLiʬzWI40%\u W{Os]1+pWvhi~;(RIޫV 9 0V?wڥoNM4"ѐ 4"6`ѨG4bI`,k|<`kNM@u,Y m<IAW@2A Ƣ9tסa58M2@chUdrFBǯNG`X,_ʩ"K.VWmQ>KfqßRO_5gȬҊ$$#كܬ)<2֩Q{IB-:DBln&i9,9'q^N&&?kq%X%Hg?MQڳ \44o=:be(Ь##d񕩗ׁ¼Nfnϝbu$ZS$yyp3Gk+I,rz8Y|o_^]hROz۰Ծ#z`2(SnHw5'6TX=2 ,;`~uZXuOFK ׷4-U#UTmF`gLn,m'&HiT<9,U湚VE5MDIxZ3UG>⑬&7dQOJ,5]RWL``WZѷU]=qT1mж9'9EuZɨAp;~A kPr>a]B;-/PUvnd[Z}Uc XxJFPQ]S%ȲwF^-PO5Fh/LZ=C-+فFqZwJɹ[Y6AMsc < TwcUSo"|}<ƷmދׇCMZq5mJ5;_''B/hzҳOJ5 #L_[ANZ '/djAJ.`:{~T]=(/赙tҋ5}iH-Ҕ[v6uk( 0&>3ޕm׹?9Th%X``<+[t{Y w(5]g7YRYl-s{iâ8I26 S9T*JH~X{vRpQ7,kzK*Ü.2^WCZ*d s0jzVت_x]SEԕmm1ɴnS}kӴ4NO7p)&d;']ѷoZvGuir,Vb[d}+ĝڷcӔ~"݆`6[*/^r$.o}1s#G:$sR}?S8ۙWG]yn#˾O,[ r}+~UΝ|Us|= z̻XL^`VHۜJ! |5>uGPevJii~KP ]Z_Xg}ZFy߽?֯=m: s *I5}{4Oe6)g2hV@Y[5+)'CJt{Q=[Bv¨5~DmHw>oQn.8yRmq~=*^QMTg%b8[?hjke,(srUr}4șv'Yi)v-*K;q}o_aUR`&[ P %?9']8ZڋI%G]88oHRk.=ʗSoSe-ڡa9BjFWqTL0r8WߥS*ҳ'ғڜd3/{iɚD̙A-ŬuY W^k{iR)՜|&u- Kz .8q髳_Jh2YT!\5"Ha3\!q\1HX2v͈eB;FHF@A/Gj4x#{S0*۪8ğeÎg$u>kBȲ6D81Z͓\\U$ŷg?k)SjN3N/[j:miubȤʿ~j߆,ὴLڻ1Vu"I^I ~5|=Э/|;$7,OְkMmĩ>Kh\Q[X-ۅ q+ܧ枖򲬣j1׉/;EZøiolƣQXO4-setGΰc Њ9`ptZ3Zutj;^.nf9S,gֵRjJ0W,կ8ӼE$oޡ5ywI =}ܬίSofMXjWr:HNOAYw7 uFF$D[c6 RVGƀ)[^R' VD.)JuO)똬fqp+ET"º Mc@y)eQckoɊj~ ubChRCy@sӽ&*Mq!ª{2kQ Qx+Fcl.g|+ؑSS:LG JڣDR?:ntXfXk#.V^km ;?Ё6XF΄|SyOI~=$׳lJrZIl@ 7Wozy*7:Zi);[ɁFt3yp kG寓pGEy\rNr,Nu,s0):W*TQwl1{\?)Tw:^&UATĄzd@fF>`>5`Nu4M:q@ 뚉+B S|Qq'+p+| Ό+șTC:RizsP0x4ҁ7Z#IFPsV G 9=e]l0I}sWN4eUj%-nmY8 Ol@5+98ʣltrqHΏ];n-`y>V9@qyYqitg(_{̇ڵqҟ7S ȉ9ޘzZȏZӱMVMY%i\1õq<' d?ZvSwCǤ hVݐGVydy%<Zwef6W?>(Uy,8'-(d*ypY=Q{;cp냕4V&v`kw''`,~;E(ؗNXm ~jz"=zkOV8S@P#p9e-c VT7{yx`(c =8 ]!Mcm+r+h+&еqZIii@f 38P [F svYb+/W[2D/%hǹnv.i q79$$;鏥Z,ahrqR.kZe}9bqZ[r+ JY)j.8I,I'\xZe6d!jDv[GZ[ =2[KDVQ~ NOӊm;\( ¤:bӫB { nsNHs@~,o*H"*hce nk  % \J=?&'ָU9M&ZSOv uDaS5,h5k=.̫$lPi^Ss[ =¸qU޵,l%e0ʵSٓfd*i X}HO4Ss[џU#݃ptQ47ev ]?EbcMhU z㯵U2Q\܈(n⾧]:Ww_J/FSė25#6gs^}=>TW>n+ZO[ZI|/9cR+<=RcM~~o^`Vcv:*幑%oNu? Ii 5ӐވO^1h쫇ݤr\)u%FiKK8AϥWeR>ַ[[r1hp܎6 Z+e0G96emʔ(}VA8-jW~99h?*9ڠp=+Cc *M4M&XJihMf-2"!J}ODޮpGӽ)j i"{Q2g'O_K-vl04kX-H%[nrzwda~d(SS.iKQ2BHOvTlUW!_I48 E^OV5? [&*݁3`qU;03c=8&\ Ep^7-a_F8'jcP2ztSTZ*;Dj1a(08$v?||e?.OV̆Wbs V7'eMDDw)%rD)9cQ*OQp[?Uz|" P5Ymp>jINUR]@R79HkZiPS-FH(AN'j NN階\Z$qryTڍu(čIx$*s㖲\#m-?>8o}&Z?^pE|~2g&z 4ǡI \, +BylR%wмaqX~WXV0V,dWY%LJ^T\jg195^}O8'1*ksy"6yՓrNAגn9[c?ֻr@SX/ٓ.C?CRykm$A&2}ډ^H;րWtfF+{T;b͉U=(I|^qc*mP7LS:U:WdTHCfd&T_+jo[tWbsY!viHZcS1Uc6ڬ2K 00l$;;D _$cI3\ǫGasլ%V֗_'8";:v14hQ]A XB =E9I]Еi1ގU 5vXi]DU,sH0~Ћ;3HKuO!Kc2Oa\)osMEMine#?ά4h?^RƽXR!d+4HʹKl˾5(s0{WnX@Xc\?+HCAc -6>@j3O*?Ȼ9ԈgQy@Ɍ_5gO2@^SRu-/n)@ڀ1NI@ZX:Yvjmo(/\qk{; tLV[Z[*Tt?y{}*redf 񬠚m:iQތ!.5(ŻDvfrqKMVc}7V\Or{ۦcUG⋽sAMYZE9GЇ]6-`y {'4)`w;1kf/8-s7.E#-:R% 1S3ΞAL݃cfkЌ O,c%@4UhCص>:wGٰ/ι0ML"|uyNnR|DF,R\f'*9+;v2wv>SW J˕OR,ky!ݭ/qq_7̧CRS̸G:Fv :m.?*X[4j̅޻\cE$c@d@$(PtYɯݠPB-V[)t6 faT|tnR?J1UccYOSNh^4lN}RAa)#ДmU?c\ c7pΡ[D vcZ HP*%QW+x=Vjcc%=&³GCu\źEDvks&G>jZæw)#f1{ljV*&Q"b/ǹ|?5z賓\]bK{~tcP'Wx抉n` bh TX 1ߌp;BJ~` ~\J4Ց+W.ۼ?nS1n>ڐ♎LXᅥ8exmRCFS$Wʀ:R$F tr *1]rIPH8Xڞı8KG4jQ]r_V=+{&"'2$ܘNa|Qoj<,p7v]B)M,4EЙ"#h2*7nOjZo((=xIf8e['C'oSI Wҁ:Sqܙ|&Ghռ!eLp+cFņq4֠ =I֧HC0ϵI !`Ϯ9Ock9eO "6wZ\5=w?TV88=9<`fʾ>\cV#m-*4geT pm_Db2~(U+=+ѭAS5T=j櫕 3Tx =~Y>WtL[IՓdti;RtjYiS\"5aVW9is.u13QSmO]hG<0+Y}G۞ MtnTLP 5(8掚!h#+F6d1 chZ1F4NiVV,sH^߹\t07+Le }i}+!פ~fB-cAW3y!܊z"?["78]vx9&,zՔ# D1ӿ*L۟_׫ I j&bʞ68)6)+"'8r{J)^aBN1Z RFH8֕omN;4(2~"I,#U%7Q]-=RcN'ޠYK,b]>5FI('X*m:?f.8id,їTEɪkqm4,(U#1ϩAVmz VaWžԧR]dS\7O>{/5g X6W4֠S6|/PcEĬi$Z)~sҎ`X+c*p|^TqZ]&H"0 M5Xh0\h534 5.JtMSafeEq 1D]IP?u :+[4&{b OaC<0DRAXAne{U{f/fhg?~q^t'l#ۏB ǥA5q qpKA|ƕçNf^")HꮻXUlcX؂"30zqk;`)!m$$8kvyΣK?6G"zrcO iXw!yK{J@=luj *ԯ e$I/Gti9hԆ-Be p:]N }" Y;4&[Lv!ӦMFIrqs\CYZ͝rʣNƪGR5;]Hjڞ0b/'g>^ݷE}x<,8ң1Qٝ ?/V^MŌF[kF+OL1K3\)s; jN̡RÀ[݉a#ZkThnbUC7G6*)AI23^YhLymRq8ֵ~o=ⲵ\ȸs\n mh*\֓;Obi h\x ʝ^2E>s.C?G} u hBKS?*ukp">CzTq8{PƁA}k>Aa"VU@Jd-@?]1??XUqRl&kyԛ/.Cm ߚRP8hi1h1^eCW-TWhM2'ktHܞ³w<% WְT*][~5&-5;l.[iocBs_U%S\[D #.a.'u0U4ݽYZ*ĸ6 $IEgw=>4N9wsdi "ktܤ]%Y2L1t[X1ZIkKV# M*4Ii?gR=?ΧQ?M&֗VNi/O?F9,_91G2›S̪i8L2p~!a,7At?ʵh&!Pqi#1j.VQM[OQI* P\z4f>54>e-n W.h+8Μ},[,}uwQd_"RG(RG}sL9Ir;HȈJFH,=O9Y92305&7}_ ֤G}jK{Y.؟-cdҺk==`E;M9JŒnzf6:=]bW Vn7U#O5eF䪟 )R}[B9?|LL;kj":zހdOt}dbGv6D$nqۓV.'i&\lqUԵcTN)Fi!8Vxm=3VB fO-Ms "\LMOjb/-V0˸>? cI&$Lá"?AW3N VvfuF-N\:w,d [BJ0.L!Rs KolH*Ob,MN-P*K\n!z G?d_?mwk+cW;JkWashBbs*#ŪIcL1,(i"lgR?_0{h+p(,OҸ 9'?*s>f ,rpy -]3߅G#RDb9%^ӒltI Hr*P۲T= H!85E ci$W %XzWt|Qy8ݐȡHUn9pyjAbI$j8H=y*m"+_Ƽ0k,YZnZ̋x\CWY10Z=#oQw Pj1bB=ekih|\G㡅DԵT0y:"YYجXpXr$ݍW }CX%[ڊ8$Psj{YtX6bOV/TVf@Y(8Kz I@i43) :f(!ҵ <4E`Ȫw6X֗Ű}m=?5hG yQZc>2Ҧ qJ@94cqOw s@ɋM+!bOlS)9}E+E4ƒL/\q3S~QTv L|nw[}~M"G}">8=1L'hKBIdTVI!rЌU&HħunGiܛ+r*f#}bҘ uyyCUnr)W$1s9kr/iC'/wEmqU'ts);qɫY^B2(HfY(dT2-Dޅs{!+94Ṳo(uV69NE)ӓ*@cdԣ;rW\"{T ?5(Tc2}is-@QҳmG'S#HqSJ&I*N9< i qڋ5g}ioDSye*YBU)llQGQ#iR [izJJyS~,AizT4lTB51­ p4p3*ӆqUs&%nmSF=)lL*H]4kW.iFA Xy8eFC i SNb d\V XcySk0m,$U ,\Q apGnS=8^zNHp 8o)ʄӝvNlW|r1V$A<`߽H9#>6嗵[UϽl\xs)7h՟{rGJn@cLHtcbDpW*b#[gheLoC֪ Re:L)꽍F~ߚS?xkke %}ciWR-Z ]fHBd!NOU}jI!0$mɮijΈ+ Z+c4jK\U IP)9-zMO"]*pN^j9[R7׊-NTc+oi יuq~ۮ$Lp? qc'gjcҢhU'-ͭ;]`RRczT' ;\6n7-,N*ݡ$}+)ږpG5fI#TדVim,͇lghFWuȡA=*G]T썍s?jF"6qj磔d,v  c-d]Q9''v@q({B/]Z ܱWo6t̻+U#;73*40Tqsj4xl>Xqb$`=(; > }m`XGI,r1޽&/١65}8ɥdiF)Gu!)ʯʥS#jn{NZtR~D̴#=e)2OZ,Vu*r9iKXa@I[kUpP:~zP285pIsR+ZqHͱݍJE@sU|Pv*1SUԡp77ZP1օRqX.*ғw *<;\99oJrqQ91&) 9T(15, "6&qY:`ƘKsE^n*!eP:`š&LG|U z⹟#/_»L %TOpԟCYDdc,%s0*6sE:Cr+7G[;Wӌb扷fbc*u'wIin5$. [XWަvFOޭW8 wĊS$sHݍYgpZ.QUe TMEjJh)iN{(2 隷 "8ۭLN97Eݼ6P)#XhRO}u0\փ9HVUJ2՜|>̱=FkZ 2$nAZRF7gn*QZ8L1Q2䎵%M棙ܻhy |bf!+pn/(eTc!+gS塸  B*[' (TqW]^Ű|'Ncw|Cނc >d늰W07\ɝ%IZ\ьumR;VQDsޡt [Ș9G520ayp&EVaqW9C$t Brڜ֝3(<zT{PÏQL})u=F֦t5U$cPۚ>@ȡdI !PF)Nq;O,RȀPUG:ԌFOZې3PzƉ$(= L#H1@dG'RZU@< T{`qA@ZҝXZNi rxTZfB.*ɹ9hN4u`3J3j c'!G~:qHERY `HUur jXzr8qK>O`QXH۞*+rN2G-N*ysҫ3S7Ҝ܊ *<{R+@>̧lW% F*08@ =@ ,4{YAT)\ >_$*x9ިN Lꪅaޕ$14NT.= #$sVu,#֬I<pM41^E@y杻oL}gKD%6ޔUYs endstream endobj 25 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 26 0 R/Group<>/Tabs/S/StructParents 2>> endobj 26 0 obj <> stream x1 0@_A`СHTE`RVpC~@U}ӵ0u]b* Jғ<qV($x`EoC!κO-OK- 7z&*y8\&n:Cw0ݿsyC endstream endobj 27 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?H ?*"6:ʜ=G4P`zʎ3ʎqKސ8ҏz0=Gp?*QE7~T`zʖ0=IǠhaǠ~TRP1xUnXd(nܨY'f| чvVN$k‹or3V_Lɉ<{MqsWT`O<3ZOjIma%Zʲ4A?bpЧIzzaq5*W-1^ʊI-~~-Eo_m gҳtDv0Qwf,JP8ɯ)-Oj9SPd7Ѭn/R!$`"g _#8S c֭3fj$ u`zʨ+QWPjN*%4q?*{sLFv%_;{Vt5Dȏ\D(l?*O=Oڧ9IߙF~6;/Lǰ(u!rzʚ1Nǥ"S@ \gN%s~U Ps݅'ʩz:%ʬW1ni㷂IR(Գ &?u#je+#jV濆IJuI^6#cTҥݜR%X"U8->aqui{źG;y :x[͵8-[ͥY8 ݏ5\;Tx9?*LARrjuCN i sz{Hi$I/\}_z65N\z>Xindݏ+ܿ { {W'%{eXBIEں-gc͜t"+axpEd+nF5D=Ҋ9t5^tzR_JhϵA3N);RJOz^P>vuP:fh4}i{Qހ(iES%:HRt+60@Q5<Ĺ+neMhIp~PDtQ"GKc# ~NjٽRQ"x?|\2c$e wQmM:]AYrfҟUi`wgD`HqϷ|NH[Ht䵹ՙQq\],kS.$O9NxxZ4e{鷹UF`޵"{6'E梷:ڽJV "2Lq^L:wkSԣVDueݵ X[ϐlg2kU/z*jT^^zzVh^"ʤEP;pc@B܎o &7pr,-e9[zg yYFk}#VcmtJaTK#ڌsv@a5(bQSaTU鏦ji:td=ʵrɣX _-~Ҹ{+t5A _Z~+kڂճGHSi\!-"&`% Dm qUCSoWZcTUG}q$okN׋ *i?oU.OON+N ;7to^p`WmƼ/5k}* ="u~{AW[uIWVWr3;(JǙ^ӡƣh-g1VRzWvQds:Gjmvaje jZ xE7p|{ڴQbda&7M tޖ.v'sgr~u(fz:Pyz ԖO1\ `)9~O\'^~rBE`.$:l#h]˽ԥu;TF8Q׵sT-NX: ]۝1-ZbIҺ@̭N1J:A;ڗ ٣ր A-)j5p)A/7f[M7̏<4m'.$X GǘG׽W$̎c?6tA(r*si1 m%zII₣B|fckV87ɭ)\GJtqSkl9.^ڝjBGeYN~Qޮ]i0Ic\׉-gqޜrS$zl s'tVt\ټ7r6f+uR735w֦'%(i/vy2A!pA|Vy=WH)MVR2#nYtQI~WVguȻU zVݯUd JrKFzrؽd0ysPɭxy&=սsЂ ovOnKc:'{u:IjNZjW#tu*pʹ޺@p*s'KV!觯Xcj(z\Ci ĥ݉&<_^ zVNsoy H}jx.(N&Ѩ]NDp ȸrPG?/5[Z۬6q4Lzp;W,rO'=8ZWi+ia\-r6$FuGOz!N$^{ct'< ʤ\Ͱr6TT% ,L[dlGXi1!ߞvwW,=g \[xMq^c^S'MlF 03Ӛu6)I0gkX| ,tz浫-S'Rj8NcS𮫮^yu 6X_S=kRC̗ Tr0uIqvcHǹ@xm4KEF펅S<{лљ"RU$ַ<;Jo !fkGCq. jاʑ.qްPvӇ:Si _5"ǩ7f*" zUpv3 FwխY l|sUF3MMڕy<ȣyMJ3o[Ui.vۈ̙%8E'<}+[QеYY 5f,z/Jt:JXLȇg?Z3J:F*YFW?1϶q\=‚9Vn=q^a6sEp3ۜv?\MU/5F]9J[<@=a\Wsu9Sz&ExrAmdyEmuVpѹ0$׽ZҼh[Gh/y1sǭJ1}v<^!e=ѩNQ摭|TT8-$a/p?Qi'b6cYM)%,z![Z\ j.=;^͞((ߙ/\4[ MgPd_oǙp?J+\'=}(ǥIIKI@'Nhϵ:#6qjs\#Di{^߫h:k羸iMu&B7a6:PBڶ fa*!@Q2k٬u};S]WLHw־z9>.w e; Y)Rmh}iSvM5 {PI0c֡ .敌+֕,x mլt!"R" dBġWf9^.y  hd%N9ȍ+g{\~jô;۞CqMY Z\qʫ;Iֺ*H.![I A"ҢbV-jXNg@Co84_C[R0dƼz+EN~p9&/ۀ </-|T4Cz9 ~P|RLΪ惋F^;!mLzҵϜ2G*咛xkS9ʁVSԏ_gQ=[8僜)*z=fd+/ rj/mER՚[=˅S*U(C`:]HY;\r[LgiCaYtFoQX@RC(88rJ1 \`W3ԊʪwzV8zQ>'>tA7UX9Ph"ueb' J*Fp۽>W]~9¯גl+Q>W8a.ǻp@sxz/=AHuFW;D%FcktI+O Y׿7W6%FU8)Z41F?TI9u4+n\( )#ZQ[4zEגYƻFgjjΟݬ0dJ;U968'JzeA +𭠹ӤR 3U= M8fyҬÖW"E7r?:(sύ^dܖ3ib$7-I% }ݧힸ9S ".I(๻MB9?-':z\~뛻H<1П{PI72cM'S~=%vlt[ڿN),.>U;1F$Fӯ9βkKkxaܕ۱{uqRk&w 2CF@W]F{FO+tK2 ;{H} U]:2ZVqL &̩=A+Bхr=z] ɷZ|;-h<0sIĺϞ7:hYK;-Lo5mxF!a#~ZuE y޽!$FG>𕓨^":.4-' *=mbج-q#0s\JBed"Q ӯַ,<qCU+rN^Iqu;z ӜAzl &pb1׮=tQ"s8rzVp0bۉ9*JP4ZYFXͭ eyk%e%H3]Şg%Lj߭p]Z(k,3oZլ."XPoB)FQhUZ3,};y HB( = \:ll$( 1 bAmt«sy_ A8B pIogG{Tyby[w&Tv 8Qb:QY]cXBeާ(XSZLjAvM:֟ם|/IzkIS`9LEHzӰM!#8)}(fJ:u剐~ \E;Ls^[[ ?ZK&W0Xdv.b攎jMy/x#JSOӢ#TE̓WuH3;:!E%1-l@+Vmc{寛6XAW+g>8m+.8^gm6 GQDmέMjHi*Oja2!jhL@J:ykIh3¯$ 4WEu5[TbcSiY2 '6k2%QFl 2ܑߜ|o%![hҺb\ Tucz&M__xjϩi۹s;7P3, 5x7gGu:zMU ~aVyWTq:˴P2ڲ#$rV|*L~8/-?j~[ZG7h[PKS ZR|Md'Smяb׎ޕc؟<^cc {[,ES=&M*&x@AqXw|&{@ W ^/b 񎌺$\w^⼊7e_i#=KZؒ[ Fm_34ȣvӸ>i7啎vfr9ԙ;v1qQaؒ@#sԞ~\mx) ]For9ԯwH1ⷼ9v ʅB[F3\,NR 5.F<9Gz9n)c^)h/t.b]cr`:REmHnLjFÅp0?pVw(L:l^1Eye1 ~c>c͵.Nn$Pr+gK.vw==SQS_K :MDI gSCғotT{D'pOeX}k)gr:Ҧa ^.d\N=E( [J͝Nmqܬ^cGzs{uŕ%|V<^KG8o K$<4[T, z-Ծ\@"u@ydS/tBKKSSOCW)yoiEmFvmT>{8ԣm. !y\| t䌆GPøE=Y?sSbxi 2=i[J6eb2?UxmS $,#vȫwOP Lwh@ȸ0(qVX }AckėRYqzSld3䳅e!5F{]"8Nr"(]'̤vPDnBGaaGstZcM,'mvnb 2 Lm'9s=k;_ PϜЙ|DZ?Ҕn/1&ڌq,L3C-u@),q64ehXF>Ks}3PC|+ϗO0#9sKeԖQ+2F k&u.WG8ԲyO$8aH 5ՎHUǥasJ|ֲ{ĻM,s!ǡ(s73|}Y8Wo-ƾt9Tᑃ_C.[+:[dӌښy>C iq֚hAzRI!ESAָiwKEs^Cie%q8 r.ϐ* 2j ^m>H$% ;m7z0[41B5+;y7{/k39W4SZ99;ښE;5BYӴV9fAҙ>nk7Sm޴n'rMxofyZR#G@jf\Nf[ 6q8^:pMvH~AsXVBz݄NI$ԓɭJ6Y9d{Ӓe$Rѡʚ1=Vd {SxCCP_U27YWK':Nt+=FXh ny$ H$OxeocKx-$#)Et>.]/5ca]T/(y=2MsHԖ+˨7ׯnh2L̗3.Ur2yj1޷-lZΫ1ǁ(?PiC4'rڥ/gp9sVV%ItfD 돥_4b~_ JǖI;nvΕH9.kn$}T܎N3Ummߌl~:ZCJu2qi?1#$bH ǭbxŚoV[-;ۧߓ{@2|ZߍoAax8MhlO[:K9'hǹߍrhv}Mjxj;]aL夋qlQ\F('t{:hӏ6Hc,zu_mh}XƋcYZ?Ym清ql{7or7W^Isq!Ys1klʘȃ8"48|SPr~G[%7 M>ٮu cUnvv(#?C( /G?q.߉OF;zާW9$J1ZS)ix7+⣷W*Qn^#jH00OHuFk(-D=K%V0dr;lOZHo-H_J*1^zCأM(B3Gh4N8[gfl c<-oG*qkBU ~ӟ~&mq[@)V9GV[*p}x'5uc  n9ZiZ xW=y&W|qT3B/u1'fWx7šN~Voi 3O;{3=* #-co!JFNzCW~xV5XFZiJ⚉FƊ 0_x? bQ$v@=?uܱm(q" v5|FotX6K@YAJlvy2Iq<$wryby&l'i$iOUMs^oÿjԧ#vʷ82δPQgIῃV ާspon3鞦cUuYCWcCSuT{R[.MQHK&T#>p¾w(KC^!*N?ޯPou>U!sUoDkUܢxr,׊uqҴl6Vy?ZEmMZ&rzҞFSj#r0zӱA\}h^C#e; kIi&Ϩ#3j5v!sӜkԽ7Yҗ/cj] #OeֲUI'NMz//Ⱥ}22Kg?6p뎤Iqtm'y AC-PKՑQqêrlδ*8E'7V>[*}1>]YHANI <t 2F6C\d*ӡpNFOZBIdgRY< aW- O>5\Bd6۳?jtv+EYwGj`guu:Z$?B𞥨đ@D"Z$$Ԟ__vLV8aWմv3d1zT*u IHE7bE v> VEh4U=OA]>Q{M仙\Z!?tsS}l--iea q~%Z ޴wQ/kRDzuicThWh>K2k3(,kkKSwlj7il7By8ٞcMru' xjOᾕ<`\6&6R8Jrv:zH vr ~&tr3T44miba(OȊ:tܧWKa4R>ɧ,Ѥ#talZM;`m?:KJsܱ?_WYYAaM2 Hkש'潧6/ AFMkqW5f+=S·>kC<ǂǑQN2ڝ8^<txcM TܷWϲZ_c}Cd/}2صXfFj6mg'U_#;MKmp <~g{xl2zljsAo:z:y' #yw_ ͪ鶚~+ 1ZŮtgqS*[ ;gbȯn$48cdlZ]Z:ky e<~4EJ1% *p9 aoVKOf~`O>XǢ]#H(;4074S,~:[0"/=-~v{u%sdFcUpb ZS@9&u(IUPI' +Pj+,"ݟ ko^]ZXy `o-ny_xQd }?) pSW QKӼ1 [FL=#_gIWV9y~cj'8RSQW&LI9= (Q{FYcuw2ӽJǮ8guI卾dʡ>r֦4oAj2jڤOo?(c>Sg):ԛk++!7r0S\d~5 @N<<8+ǧ.zP[RRڵAlsꬥ!U;s3qErbUva]#~9#(8YcFwLq^+篆>:f8Hm{' @=MrmD^Dx mS2] ?]ƾ6S}}kǶG#ֽQƛ^^`ʼ[OrxT"j<4 /b~Y~Zh7<6+Iv-/vU:גkѡ*|s"Ҽ=Cs.#3Մt[iSIWK9ky r@A烚L1a-7JFFM|,Jec;sx3ŐD^!Kpq?3-{VӂLpG铉5 ^*ݼ%ak[yb9~7kMn Ċ6&J G[ I_9HY7m=Hh[ rk =Hi#P%w;EmwCM/H?k@4yR!54;]j4!]qѷ*h$ g`Yu}tG|nbA ,0Om!L 7pxj+ByⷉED655 e^69*q^hۅ'qZy''18RTIJ0̙'R2cp=G4$Rax,rb+R̊y54Q2"}=Q '֥b w=}LwJ*t班UC\Ub5+q^8;ɛ5Mn"eMǁ^hɧ[ɶ4ӳW =s*D$iA??^%o6ۧܕoOιbF*Y= HV;>g.9VZo$qW;Z2:=*OF+{piX5kQ_^IB5X< /q;ь XyC!bϟ?09QJi;Pw4zp9#~Թ) }ּu5-G~&G9EOzQ"FM45jOgۓ=>*O+%'-),|suu{?FhVG s3Z"GdcjfX$҅.`YNC nf.@ PI#תWZ v[IAI#Ƞduǥn=?/g7R*wWLڜO .Zg'JB;?P{&xv,c&v1gYtWdhḌ~hf3ڸ/j/;X|ſOM%|s/pA<*'J/<Y[ʓy++2E"2cVX7sS7i+IL')C2\eő"*;5N"-(Gl)褎ԡQON9MbyzޠR}) nKSN'<ҢWASwz< M EȪ|Nk{WXu; ׍@QRYUw!%[li|0q_ʈ?*<ꔶ*Oum({{a^CXKjWS t*x kIdO`sַj^[r1'_崑'|S՚dξܥy]5qs9G TtЯ&Iݱ[?QҽD#k؎?u~ust^ 5`^+P32; 8=T;/M2 lsUQC$vZl**˻թ&*Dy9Ѻ:Q@rxFǛAN#n3H s/Oc*; .meki=Zךd_o8ۻ_ӵ 9ZF_k+nyk`psX(48s ;ZK83H|˜6 zѿ۽z6qԪ+LX&UP!ePJ&'٭Z,ʹ]_VN Tw5IAg(c#kDux\ؗ+%"ѮQj#?ތk/gv+z[% |[8$18=r!tiTyjZZuE:^}*}Y,]q׊'Ҽ7co!>P%GOJ'Sg?ctrxRkdwb6ޕz{5隌ζus5VcPQxEעxNk0^}u[I}b)Ӫѕ=X^xڕOmYpG='#Nk%-)4:SM-sB/<:k||=ƮZ ut)WiZ@R>E|Gk6,ğq\'43jǠxB AK`әu=\Bu;-8=Eu7SEdkL#ypTSgEAG_m:nY&xEݷ&O\*+E n@swcbͻt_U>[JtɧKkc,j/n9kV Z砻hYdclKov߻aw nDuE>U4ЪHʨY WxS\$[u3?X5RQYv` .F5ՅS-THZuG#؊J0%"QU 7LLe~'hP4Mf?ŏ|R1@Ҁ$qP48aOɦTaƨfc*Ap8 .H`~$~_oovzd,¾rCÐ;W^kieyd:T6IT;xYXzNf?V!3$O3 cR,V!#Pj-bVdNh3br6SP٢MwWBH!Bw$\~xb 2:ާ5 9ϭi{*O4ug S%?ғCS)'8-λXe +9 |)}u4j,SOLrF:r1Q F  H=){P #-Qȫ5Z% }i~I2*P8[xl.>8F݂K{UQ\"KHgi]ϫijL05--5NG4`ul`38bc6dKXy 9͏#k* ΅!b;B[B '**$E]8ZYNvYf-8ϡjS7hzȴR)jܧwQV"'h@f=*{PTN891 TbF<@ϥJ܌ s֚=0*G(UXZM+eo= LZ:Ddp}N+)Co 2=5fuH{ݎ$F:CLB' 5G-{I<d_ۚnѳgT{4id %LiZ\.}E"\͌XF9w7z t 6]йy&7*PksZIr ]emюUq+ ᙺrud֌3,`88= ]*sr|5%VI} C~k-:}'S\M 8}# q9V3uj+M;0jA-01ґXtZ,i.Ikڼy0YJsQ4[8/>յ;tu2劼:׽Zi;{HD)aG{b +5UpF1T-qR?ϭrU9V^p&6Ef֐D 2j`/JOjYk a8k8Iʊ&%ω&k9X)䇍*vrOAokC ?Z$mGxE:{ 0s;ld4fފ;>gG.L1'8|c8?MǕȠݷϸU'dzWO_{pAf=Xеtwo$+wWeV aޙ]63;;O圤M^EˡONYב qbs>.(.{|>?ı6S|jS,шdi-qrqr1S[{v{qgк|4R$Um3ohˡh+ g 5X3QI^Q6ӰܱH֯qY^!8ҁ*[GcK@A](46^D^ӣxFZW$6ds:Wi[9ѿ&Bx]LMi0=~lT$3M GQ<`+b^iؤ N*ZǀHO&*pwBjFtZhޥJc%8GaGJSVzwo,fVX#b gG+:$A@ 8;#Ҡ5ΟGHۤn[ڶ`۟Ҹļ\>.-Βdp?ƴNEhLmd:eQK3&dh6+I"אFmO:y>LOM"]2o}] )O9ƭ:ܒIm Uu.JZ6gJ% R#ͥ'Mfݕ\2VGZB-5&;bF WOq#TfG+x4$VKvWJPcǭKkIjZ2P9bkuP[^L&,J {kjw/垐ÿU4۴RCS撌ODv^l0R[[%4cjXڡF}+c.Yr8 _UPH>_Šx,&>jqU+7Es6i1 h1aRn-yG%4vUW6S6 a [QB):2&( )Hf p)Owȫ=>\GҴ "`(®~)GY>!ҰN?1ZƲ|C _ОRx~ǺVwc+̾8b\&G54:l%}?NpYX2u^%|'IJ9 Xl0Δ[_Z' }%ɻP>Ot_eWcJ}Nɐ =3,js <q Xs'8;p>o!b'˷ݷۀU^Xw{TQiFH9-~Kv&l5\K \dh<EJAO>&%6z޾eˈ\ڔQl8ʎH#hQwSq\]en26tBXgoxjK\Hd2=q`̇Rf):_%2 Zq۩BH-~9nsMLܜh1V(Pwg=N)1bQRKg"zAIRX)ǭ! A?#G_4;K!ԏnM𬌞+H /b+:;J)h"vKe ʯ޼ 4d$WbFVcM8xA"9yX)Rj8۔ϛ^$G_נGFK] W;R; 2ŝ+4cWW֤Ԥ`d{?Y%9$MZ0z]9%77v ]/=|X e?0[?C:=gёnKWfڕ@4;Рf3E.? )xKSEB$Q zI^OkgquOZ52?oآFgkKv;\}`$kJdN\W,?;}j\Y?Zs)̎i1[~,J%;qmnkttea—R+ u1jnC6C̹+w Z5ܥLs<S'd5릘jCLr\ߍh=3'xtmָ߈Rzvt ǰ4㸞k<y0zפN#;jڼQy9vHdgA.u<,(|bp1K[#-KOi,`9wR2 (r;גMگc5bnHnArY]sZgH(q e]' <}(Tr2(/:RH1P Q*x#(lćHcSDہICZ.vL3dZ# jXf$SN^; ) ة?Ċޛj-"c\swewc)TsAGE(ӬǂXPdJ)hße'#5ۮȂ[\"<2 u^կgiLi2\4xWM<Fc5fm{]E.@r#>_JVj궭#pS2L#iw}3Z;aב.n-Ycd#+oTEmIb&0PxjpȭH)&:"hz;qcI4b^yDDzA5ZA=[KǐvzZ-S, v1PX%p.gD~zgNEx!ܳ/Ⱦ:Tt @=5xM tnѿ,wݹFX@'5]这zQCm&w--?\f{] ;\j*kΦ֊^B?J_›A%3?g7Ge1C?vɬWTA6VL7FGP3aҔ thTb4hZ7`ɂ].y OE}uT6[a8R>A})}~5)#*mUge4P:}~ ~y55`಍=P=* @֕ʬ ps}XX3rOETIELVoC 9-A%;~}Wu5"}E5frFrY?{jH;wZ~"|KK#YVGA)4sK :TI`<Pj^ Fi8 Dmuu-P5YDg,p3]h` jgv 5M01Hiǁ7+})HMHҊ1CʕOSҷ9i=sFh٧ `4@? Ϻjח1#IffTk.C"C#|~aֵLݎ pj.=)FxLΣYj\ۍ|ỈCa=o&RGֽƮJM>bvsƧrz '󮊹q},ypb0|~u\ʟ)=]4=ďn-Y#m?s k#zrŒ澁dnW29鞿zoZo+W+ * ?LעGh.H?S^v"\lhG]۠%dHI=37L"kdN}z(d,nq3M$9?P<$7U^+[s\Ȏ1)+ g3Lխ';v"*+J(@$,y*ɒĩQ)ap}tDzHRYyJy+w'\_:9䍏һ xI#zs6p;Wr4{c;QJf/ܒ2;"?E.KVWT8Xv0Ksz}Mn(ⶖ7A 'zTQR?j #(9J!S/<֦ĺC]ī+~`4 W:T^QT#j&9F@np8UIʏ{m|1{Jkl%?qVT߼ʖx4ZԐDіdUp<^?@m"0;H짡VuvШny5{Ļr1;Izv~:md۲e!&iS{֢u($& +X"@NqZha2Xngp jI2Q~J JeHdv GQ[[[r1ˑ7 (x^fL"Q)*3Vd^l-{# X qEZAn"P~K+^h(FFd޷k2Fw0|Q%tې:ǻz޴.4zo}8HUl$c듚5+tF%XDyPnv_``fqmA'Ku[F(kf川}pyɧkOCV7–d#A"݁ ^[늴ZzwEdX>X֡60#o*H# *J˾9}U/b ZyJDjS8d@w5`F%k&!ڱʣ9ztet*􄼹 1};Fue AcF eZjO$R},Hd uk1j" $tqY7$19}~<SMrH}uaXGy}15+W 38*W?*>+ujbԋ@cZ mz7CyzK}?\c?^O޺)&R3Jz%VIPM A󾤞N}.$񯡼(O"z9=~+Y`}k .[ E.krWѾ6>3r2|@.u[8tC,}-*+p<ǹ˰ n@z.}Mt:}"mG\>¦޽EIuZ6bZr%b) 3U3YJ @Cjzp+>ZCI..$"@#= 2?vj?ZCq[2>Ԕ ҵWKBM`h30K8/囓Vr gfk[\1!So7$B\9cĭ,O+BN^ݳN*$ 4H^8Ʀ3ܒOkn( tY5.kw9p s mvɹp5ԌZ\zµLyss3o?fco J>8Ap|,Ƽ±㪋xAYTA4q֛#m\w(4\֊b;nofv~m֯COW-:F?OU?\7faJN5sbj;J(( QߞQOҊܔ|}1Mn*G a[ 8u8%<R6:sBE|ijHsLԴFL}.ޚ)~'c&7ν|k1ef9T$@*n\bޕF`:G*u9O <pqX>7MII>^8le=Þ?҆VA3Ւ}0cJ@"+vmmS+,Uk;d‘s4[ꈤ4%Ihy4'tT=fnc'r_3=Ƨi csȠ~"'k 0o7ķ_MzÈf>WxrT99~m#=R?v'8 ;U.9p"4[YO=kEW+ٻV}InV$g־ k6kȯ`_Kx'[|+gqA e,Zu/|Oɬnsx7/~vwAEfo kl4ԅy1+[#pd9"\bqopR/@ ;JgsIUw/(\gr 5!{[CwkV%ISEnĀ uH6 g9,WQj׾fxcM`P?xp9WaJMևrݿ:K;H94F?b{%P.,X^,hd@6 .',/-_8[:,J`|{{ѪeOBP#X-sяzZWgBKkRQ#չcT[32cF~u ydAS0Rv6'^zhlg,7'T !(W>Nw&~)E191nW!Y7F ?;ҟۡ>|d 8CTG'h6@}@؆eKsqDb/zt΋O s9?֦ Vyjc^*6ni{<٩Q 9'5fѫA48qt;zƥAEUFk[t''*=_JEi2e= Z8]v-i^T=O #}~ooΗ;fIA3c(_۱fS܂ sg^1i#񣙇":T5e^'t9}P$-?y["u4L+ijRNŌ cuwpAxu#{`DΣ cp+ Muѿ.=K'q*9@VJ3ZOٸ{xNsZ>+ eሠ(ZkJ'|j+$d+".'Ű2г]\qʒ>r&Y8E8Prݨ}kM 5q|ߠ\5ap#VN3{8;Zj|C 7̭1UFEur!16͌up=NED_|T֡OJ<-g*=kE4JHJxJ -d`K1׮:0$Q^Ior$qW]$͚lCJ'f+q\o4ִ}B$ħ!@V}k8=uR˙5i*gz~/54._M c=m]N-VM7ˎ{Y 1 !9qáZ87 (J۹PTq,lHј=~2cUO1I'ҖE*Y =QW*T KHk_;y/|1 K~z}k }}Mj{)zRrǹB5ת˙(ڒ*:+JQJV<`TBң=jCQ%/;2M\x><g!է=]MQhPz敇 ҠZ^;RQE 0ҊC5YӓC hza+01(AGMh($kw!wh+ qQ"~RAWD2gs68lU?S]-;nX:[ya!whWsiE[GLɏs;Bşթʋ@?8_֚Usp3c*k%f2t<r#9z*<\Ԓjp^xƳ4c ˁ cpO=&_$R4@ ][,Yr@z4R0 yR0!ݐ ǷuXa"357ZI[wҬ6>V%@n[Ρ,iP6ěr~hݞ/*.cǕu˩~'mƞ-n;G񫱝֜Tw0-N6w%*V |B*G26 >1Lt5,nGKy?*Sg>>ky?M]߮?fx ogW*q 1"Q ]G9{HUmVs*Xq]ܧ>k]jle@Ƈ +} ЬXrk褟-љpeEC+@?-ݓ-ԤH<7QO~\qJ \Uʏ-Few(u# nQz"21+v92¨h:1Q>v*d_,sڣrA;ZFc}J.j燵HMyd=]J BѾlc>{4ϡ0J RFƊ愕<=AhٮH{\Ηxgtp^sk'hI8 ?Bέ #"̩RCQkvҡxtnPqW* g-OWU'^[ykq^hd$^Ojv |U$9K\Z Oi4XyOEaYΜ<}뾆 r1OR8U4S/,OlLUк)`Wdթxv>tCAyS8PB ɧYݙ e%4K~M -(=Ǹks˪ J-uE! hrKGpOOҥ|حe9=Iዀ`Zzܻ Yl@e@!V`@߼mX ߶ :\, Xג<#Έ4h_E'iX&Yk""w4{U.&f9!8u"Q圹mnI#t SN(}iBm?*AXBGR`c]=r>^GI+K4ɏB-˕x]|'5V-Lӂ1e9|RjܘTYُyW:]09u;Ա2:xEU֚0;6k:-$Ѳw 85Fr{f eԓ5F*ۣ'ݪ)2?} Cpe>$C-Ÿ+3dg@Hi֢RR⒙,(b o%>$ #{@?5%x#TѿJnxN%,jFbW)ddsG#fY\uA?%lFiJ\^0GzQXa{SP)VD>W&§"Ҥ Z\+(cQO.WC=9^Oy/&xi7s63H}0bHhbtClz u40cbD0ڞg9{T64[* һCs)k4bE&i!4Mů8գO1tVc_ߡ^j iI"F+ 6*"ƈ WbNF;3dXGua=i%6\S < ˽ V41,YE+=j5 CWVvw;k] moyRJΦ>b*W n-ٴ:88w$ io,;8?Q)nZIvtq5>kRnI^. ZoҢe.Q6RE=GRXk7B'ީq[-a$spkcW)4"1VJOA,nkS"&# Mk~_>ӦͿ+K.gsTl悻hQ9" 8o-wCQ/OSRa~DvҖÎqŝ*=\5ie[ҭp=^@jUZ6M~=ĺ[L D8UL\|)yn>[:#uBu+ѪJ%/OcSKޕ~¤gκsڋcp8!W(\5+2(Kp'?ZynHc >,4&Yep8 I6*ƤuCn:烟J P8 8MQi4"KNY[IZeij"6 q ]JqL3l2+Čc.w'JjnYI$`c/@VJ #-YDA iD+ɕhm |ĝ+-⦶~".ꊍstq ~c(35}c93 LX`QDIgSWw-e+ilZup'0=J^[mb 0v$=gb9j=IB:3 X59|!:*6 @QFP`˴a &y QzZdKʲJ7G7~_ʺ[a#m\,K=0V{Wwh]+!%\{{9S|cQr=4pa L$Xcx"Ɲ"J%,"^2voRvm;Akor:~>;jwO574z!ϢWϑD6A9&(I _A qʴPK2FJEj?=2qZH423ȫ|dcw z f|N 4뛍‡|c{]NxiU;JkmSP#(яן|+MŵyVRH!GB ws[#Fv.R+偱k^F9u+mCqTvL,T$VџP־3fmΎ^YoqUSӖ]&a?Q+DS5aFo~ F;m=UFfEPOث𼴹`7]EK^bScּO>Mv>t߂j1(99犘:'樼TenIY6o"+{T ~tSI/ R^inlV^!e@Pio7,eyD#}G%W_"r4q1?ȃ66WFҹGN]+&FGZa9'`k#b͚P H|;){ &SH%8j1+naF~5cV#r IU& ;z(Q5X=ulX:~fGE$=3A\D7S7%Ԡ*JЉkp˟ֳpY&cxj1dsX~-HB\/[=Ci#c2ECjDnD{UNc5)NSrhOqfr'F1֚;NRIKs`\j1KQQyDJOM;c ~S˗CA!a+-t6e*nl?U*C@6qoE$_ױ?/՝Zm4iJ+śpSJ g֧WT2Tvln-!eGL8U^sW/SgSibwynS5U|ZFkiomDScX$im8kulxc|+)GzF_--M:y84洚V@x4Dgw; u|V30X C(s~f5HGsy5,lÞ-7-#ߍdM˷bgS[#╯u4loL69ʹO}.d$=C SnZ▊dK=F##kWLfڋ%t]q*ll%֗ e*-\D?ٮUG[G[ FX. r~3fa+cjde A2 u 1]#L}5kwmUu?P?f:f)sqp-3OIaukK y$GvN|ZΗ 0n>Eay:) ;c d ϥ[V0,Ob5  U@zeZO0ЏĮr OfVX 'wGnxE 8o儥=+mWMT@ω @jdD3 ŠeRkjlG}Gņ'zUlFy>c%!O2Hdt0]$wX杹`Mt(%sWЮflȪqI/ c8>֭st@Y jME]nNfѰp%\8<|1YY\!/?pW-O I.C)¡(V5'LdQՏ&5O-8ӜFܶ9PCiu_ Å:*#j9{A0[t=I{K:fesRIl =Q"r3[>VCgR3+sP Ja\[y9+ZxVH'cuvr1S*(Mq\tǏAJm ?x|ΖcƥǡjCǓ ("ϸŪ%|v궺0nPlOZR0/⒨%foNJHT`Vq`qW6 S.?Քc2Kp[Ո42d'&[8TY3C7~0*ԁYϵDU}*w&c{aP;@tQ-V48K9Ri<8#4Uz$!pj)"84;oh64GWIVlHdr cceE9Z!W#5I[qJ=Uy|?2 ;sVljw%N95JԇN,n,fkwEQHV#C[N7&GS` U*j緉e*pS^8 {P4his+苻 [2!dG쏥DU/7^Q7;uA%j[+I<<[mQs][rCVvM=j<޵0=T6!)E~e8OkO3؋kfƤDv>麭,13d9YEmssig56`4R0P8U'f:QőY2q?+1W.d1VԮr =sUe*z4yBjF HNFs*4h.lcsM:p=fO/oJhпfamghmF2Oj3uuL4ƒ#*>Z#.VX{f5ħꢣk[fy*7pp)ywcjM/d#=jѰnе3}~U߱ǎ*( 3 endstream endobj 28 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?8=) ~TN@'2s~_T>3y@pGָM&53Mʀ#9_dk?+Px5?酞HܢU*c76c G~ynBۖV`Xw-t٬]r +iJȩbrGNOAmpLQ?*E3#GtH(I@ 7~U%6 & f?*0=O.(=J8R=Ozʐc8>@zʞ1?*h8aR?*AM@r3(?*o򥤦x!~TC@ zʛ?*P2<ARmqI`Gzʗh?b<?*P`zʗ~TP?*8-a~TAS&(AT("~TzʓhI1@?*]~TQn?*pQ?*\R(;~T QHA?*\AQZi~TCL4~U~U)HdEF:ʘTzʥ"E *=L*=SL"!=Izʦ"Gzʔ/اb=Nzʖ!AS&nN11Ƶk-aWvL|mÞS|Z<^_->S\i3"nh;}oR75˻u{QYdoz*z/tm糹xz;HVhr?0L@WA\SRv=Z+)~7ee`0/tfL`o\*}jqIU-]+kiGw ݃9(AV޼axIatu6"S$uWx3}6W⸪Gez)GS?|\Hk55H9JsRIO0ksaQ]x8ᇬ-wåoO>s3_!ӿj8J)h1)h)P@ =)_ʤMWa,2p{[Yr2qhAU_aHhCҫa#8@rVJd!3;8,}h:al0Ȧv5ɹL!ӱ,J` 78s v ٣A =rǰ]v屌Sd xIH4Ji 4M8 e4Ji:]ަ< f$yIsW hL85"vsgv!kBFrO?7ҊbDh^ti<U،᭹YCܗ(S&?S;5vpAj8Yd *ŽT q݌EVHMʟqYfdto?Ck G>A#=+W^w4lZC ( (zOnkhywle`u>ձ{k:H#]TQ3֣lmoo.4+\Oz3/Lv'cL?*}0Ӹm# j}n=3ҮYǰPd9+ ԑ٥"j@٠W2%>Cՙ֑_:eҼGz˺_Uy iƼۣrx#OΥ6?T-2[_ \mI!$-Y mXTHLX\̟0tIqQ:Vk[ǡ3-/w|7JWL96 ǟ=ֱEttܘR, 9AeOᖍ~ kkH6ۭY{ˏץ~n{SiQyHuRZ`ZZN@.9V:Kn|ɭ>h pXdq\Oz.< k]wXn%E9c}8jٹ Q!Xt$WUҵ),$\Қ@zτA#"l$ pW xƪKM}/º} ywc*LhCW-?~#ҮǪO DkBF8L1H:X 0/NI%mq cN&IcBA q=qOPN9Nhsy Br`fsȏ 3mH[;@\hNCtM RFZq#HN0~JAHPmu߳ǐ;!HH!#-KDK& 8nYQ-c:z3*mwyqJ'֐¤Nqj ͻ1> Q$qޝA'8$3F\JCN!78T[Dq\0Fd8l`yv]4\ "iB5(g|j˹~`r +v) vI6I)T^p]iʒ@GzFC5 4*-KRHM-Eu}*J=dZL Ҥ)±,)Jm&)Ԕ4bM4IKE0m'Uaɭh8^_ j>jޫY!–Җ`>vuQ@ϏCYZՍ{kaFHrR}kJq퓀U& y<~XR$H9k7mAS!i {v EFAb1sdcW$Uue#0kXsG_Yҝot?K¾W>ݪ+属EXߒGOUVp7ykҍSϗ4[ dQڣhk7>(u-\~ß[^_ v^^ ӲR!kJϸSWL/31=>I1\gŧS"XZSG魷Q?\aɯmZ]WPN*V<,ZxlV<Z+-*2ݎqZd,T8 z2Kvzbusg-tJURdRLJQE/S@m݌g[FۼɕzUzdWAġpi}yqLsL `V&M̙:k=v=+ ֿshct֟蟏-үǢ~?Δ7Hii+BFԑOѶ3 sYMlR1ay[X@ hfqR ILap9zOu^C6 rqM7')Rv]Re܊Kw}m+8YM+SҼLvF w/Ϗ,t޴ T]{"bp un6$9OV5TpFIN41`)md~잊:9sM ((=AMvO$#C8=+6'h81 ݃ϥg,ņrOz#y! "\`gҎk(OB1z>Fj)I|*H?Zd!\CI[yS#x©Ro=j#;;o ;7(79b 5f{ ZvIIHM)HBu4ԂQ^ǷTC}IH:SdX) J)i)RPhNc) +Tda4ڈ@ jdu$F=9A˰ctQ:?[n*|覭z#1$U@#5tiY$&(~P3m.f+$NqҺ[Vֵ{lCơч*è?Zr1c޺UJw[/WM:2^+>Ǡ.:iye& vSۥi^x]ĒH,rw>PBr>{T4)Vm.%TI7guji|5+v;Q}\Dx)zV[ZtS\c XAӟOZcr׺5d2; +SR-×klf1*ܯ\<ӂhXBqmi5:q>އW[~;ͧ2<iPJ[ [-B m{y gj|S:Λ '-=fKs!%w?A[1HĒ/F.;oH/O ZAr#U4,F~&M[׬Б F?\.l~җ G~ 70;5BO}jaZ6M3ZYմבqQSR3]Y OJ/~)O#m2 Mt^5<Lqג yׇ<9裿1IaqcZi+taNާk_'=G9^sgZh~?ѤgIqȋ&;cz3qRDN'45f3hҳ<[yui[I R\̰W+| qvԋ764feԬLcNFA&м,4$#GwmwR*_iFWd'~S"*#J%M]4֞iS@31H ]܃T)P(#$dM1J$k%V4I׊/rF00*aB??J9 3n M'P֐m8?@ DbJ3s%YL(݉K(zx%qH(G?ʟemNn#&m#xX^ΫxuϥkYi{vF7|Pg.ðQXaOaN%4y6:vGSjBH'LQF2q:yVeG)69'*֡~as2qΫZW1]v"G"ȹsڿe{,|ċ&֛vW#+Atv0O'c1V'ׁ+ҼodEyUUЁ]֜\hO Ęg@9ּMCKT98V0lqڙ;id36ynjWC 3LMOy 9Q"kM:I)+#Ц4s^PxZmVc?&peh(XH%~em桦x[HHRݤa\d ?^m$q9Y63G]4bΦI/c=Qiv5K{}\ USYm2ɥߺ< p [{}xattb1r-*\!<)LP\v @^8Eo*XGPkMUrEE,9sAtkhGN]_]5N6?.jAJ( W+v#׼WZ .ٍ~`Ǡ[WFt4ш[Z[/Hޡy=zk‘x,[skR7; [>>=Ƒ{:[H~Y29 >)J6M)U]YeYNAiRA wQRng* brNGwUk$r)?КT/ԝ;Mjq4j\-ztAn5M9g_<>vHQU B2{v?k-!?!?w.?J鐆sc]n%f!/(E1TI4fVs#ڹ3w^9*p1ޕIrǚi.څʫ<>JZ_1zLR[6l|JV X6ciBWHZM{#mO_Ӷ#;m$u-8Q欴f y8'Yw>ykrFk\OtGdo5_Y^ ~|V5dNZZh)ȑy$=K;9T6~7l/{+QA\ztpH݌`vTқmiF3ȸ穭1jrrpj&A_E ts˒ M~y%xCI)s>tp!Y˒p?^[^)1Y$v:15WQl>Ԓ;ʭo~̠Ss>[C+1U8RGnj}m:8EdN͎vH4.aG`3[g-k+@+cb{ {m/=ʵYBTk{Gb`7PHGPossioostbQzRƥ75>qql\X.Hz#'I?]ȕUhՕYZDȈYgf{UxA (ЭY8Lq u>ify޲ӣ-KtZ5NQʑؾ2B85Y"Lu{gQ-IP16zV&;pxT^˶:MF3'R0GV4i'h."e'$qqzUte`Tn@vZmwb,lm;wMd1TvZr_fneS"*{pj9RF qZyV=-i9A>$6:gҫiYkbxSa?\V*H *rv}/͝S4UbIrONy|ҲW+xwK+{i#u2 q3W hd\ͲLۥM*'1bL4.<G[=2+mk"zb1exEt<{t 6Dʽ+H)m:@2pk,?lչW9a\nQw*Johcաu[c@OqU+CmH_$ cY1-i|Ift WKCs} D,[Wf C&R;)6~^y;Ϸxݫ-Cn~!wm›[Im!N]cgsISd^B$#}\T KqlLq˻%ϱߥjXMD_{0jĿ:'+d`5k-rAm\a$U˘a)b& qϦkE-1hnE*HF@'0{ wv0[[ojϨAO7aЎfi%uXlB<ǀz]&kaL0V/dt/B97Ε]{HfO ֳ3/l(M6Jܓ $_QPxt6]_Y-\ʱ)==O2kVǦR ,OSլr“ǛAtI<rAsG-|ϳH#MK祄K.s4شKɯLo.2Pg*q?qF/vz.QG#{y> <A\C۠nF1Ln+Tu !B9#%Nr#`;q.4㐻0#}joݧʭVݷo_2++ q&n3K8qrMy$oZ$ȹP7 >5gg'G~5_Ė Y|945z?umif NGuz>t4Cu+:8}+oerŜ*'DƯ Pn]27r~4δ"21%s =KO֯&gi!Q=AP{?_Eh ib>ϔciTսEmKXxZw4MC}9duOJo]" ·ANbFt'w6Zg-vd,T?qVY$|2|Ӱg]}70%(4cXAEd_~ 'jl-0I L9R+_iI35lC#ZPg ||+خuC]vI8]U^G4Rmv-,dc]Jϖ`\.tS^$03\o gj.j2;G&.!Q(A¹/˪Kd0GP{9&SN[wie%WKm ZF}.ޙ ?cYEq=.L#F;I+b;ȼX0;=qRSM1R+1t{ԌD , 6ܢKK!?dMI0x++6k`tLsp1ס.YG8ſzrA#8"o/MǕsYf(وeZҲؤ6[0 Ui qӨVF-;n5V䫬0Un-w+`,O~UUi=İ,HцZuqk-1 .Bwg1}+1nZկV*qVmEQbv8ܣ5}[r39 G Տ6E}#:}IbTl1LNwJS@ޑSCظ|FM;cs+`u a>VOB?'6@E)4v&qE'Q]?u\:_pI]U\ͻq?⸢z텖i_-Mm<709I`ê9|}!w[)-7{Xh!,]Y2psW_D]я){D>BW\i8ex|#-\VCExecog?ZZG`n 7:U5f ~\ʕJI(cfXNɠ 0j|h\*=E`v)M%Z\Lym噘momm`3">svs1\]2y=& 1E'ۊ:spQEZf@Qsn\>sʬdd|C8ְ{Y#6}1*=Djͣ8,na1YVib>I#IX(Ϡ~e*"$@O^*/Q3ŴH\'t63$ʯZ׮&'s%Ϛ%|u<\8ֹ`t)U-7fn;H@*ċGڔ82Aa]剁l^yi!PpRD77qki/±*1,Ɵ5h۪=|iJ 6"TdzR4Ü\G&T U,2?SxբYNv$q8'9?⷇K >muG’#\/>+mTlc޺~(啙^&t+[n$YÕ+F}r9cI$]#)MGSnnƁncD ҳe] o7v4ZZ`*rU 05:O uzjJ]ƀ3(?u ?:tIA/oqD, 9,mv.ۉ'GmwtqNZw҂QZjgY`2 k(e1Rp}qOmf(<\Sۿ";1Uv;B} sexQfȮ! naUkI%$bziww0,HȤ[7i,x#rG>n|{ *1- ̠*6gY|+kX:099+A,U1 r1OjE#m;j՚[$$։a{F1RHשv}r;9"-]y fN +ikiFgg*\d-[":3"l?NAzig(%xT8+\p4׊۰Ty%z׸bXAr#ϩ&i."m`;yJX61f, Qy,Ke8$HnBss&6~㞕]$tQpmZ vIUדu޷?*C3޽>~ǃw+w&lj7'5fQ5Qq[}Fe b;J(dKɔ֤{R$nS.~A| U$a5͜!T>{boXKI9o IU D`cU=z9 :fGNp;jKNXrpFz{sXv[ՖYV;p+7bkF2oNQJn?wxXr+ټGL?3?sUi'дK &-ԭ?$*s8;VLȟF[&(nL2*}^O.Wq Dn I$p*C9ԶՎ0E7.褄qmCQ|FGC%æ _-X̎@nj+ ʏk|b6خLpzW<Z+iP~l\c_ҼV* bǎ)ݩZЃQj&D@ s# @'Z3MD]MxIέl9+.Xְ1Lݫ94:izm,@ ozxm;z>!D[U~xAc7y2WRW#PaTڹ?׭Uf.~LDk=?O.qyYH Ax5xY<$ES>q4zW9Y{|q5 z ױkuԬBO 4kg_jge@ 8湛F#eHLQ;JÐ\<;yebJ".mWyuSsc8}7 'xT|`8f,rǬn]-U$aa\ e>{ o5?K`tj8B3ݫmH"ڊ7z y kf'TqMw Eerr3kʢ^g'xǡkZf,ir;&H5>1Q6cVmM[9x;&8GT@K1M{*;gIjƯGhQv$I;ҫ6GӼG|\n"+:m3IzWM5falw:d#|V*"BH~U#4/ \2۱?_7=Am?v֏glIbs^0 G WfҼ[N5,l2\NHO_HhD>ğ;1Χ$bnwDsHq]1Pcל>8װ qjg;zT0̔+HP5xC<ݼ8#Izm2:<-{Rm1E#i$' nktu^~Qir+KHޤpN3Io o5zx|6pd}j8TW5)Z67S0䀨cPj!Č j1CQ\ZkVJ^HHpUUݕ EgOqH,$v5_Zf$3o_ m>=ZOG=Ηܟ&bY^́Wz_ 8`o|;e #ȏ,jZG`rI+3c竩FM-mI[僖qM GA\|7\`cH~# yT0Z~cȾhjGn=4-ǩ%uxfls׊OסP6DZ": Vp^y H3:Hc)T@E!p,{{›2.,qMAlŭn-#6AJ$c̃p4s:}~O,r@#qR뫣ǥM,kɼ/>+M 2-f8YqӮE&ՕQrV6r:qQ5ihi:_g*qspQV<|8fJ74 *Y w'O?Q1\A9R)fW*5宧@#)ߵs9P}oF41L9ydw~Nk6l؜U5T"VECBz= "fWJ"fe܄yo PHck"SkЫUf;Uҿ9v rN(#޳u ٮ|ʈw'Yõ 1N5e-1TR{yyZiR;֣~cvݗkAM WiUY}Wu6\"%BOֺoxT2)99xMAljt Du("K@{K $Mq[͌|=ED/'mU_iZ;36jyk\^Lmds=r׮<5[j03mFd$NװxMJ5V@HTA؟_sJmݬYwf jR09|}*犼Mm$<~5x⸱M;M[{ҼmN{JK#?*y]O}\Z:>)ydN^F.sy ٪p?̚6_؁\՟U,TOTou}&\0Xr9?+WXP[J<&W4+Ƈv1ן˚oT VXc<54xڭM$nh"0=uٮtEY!Hlǧ&_ZsAuh'd%Q!}ڱ {EUyힵ]]it44̧WZZWy$l7rI[F։k$gy 3X|ҥ&/u)G*-՗Ycr: OA3Mp²bקX=$󓁏U^ $aOL*Gx^.t9bg\O4(9{YU +'tk7w~,n㾝{\l,A».ᾳhnۺq{EeQJ{;h8m[=?JS_"|ۇm ׂ5(A=%::>Q^񝣃CPKr|/e^@>訧Xug'4;R*5--' z);$;F9Ή' Etw[1߭.3+j)*J1q]U'yIBzҒړ|jHjv'.pca?{M괘1WON+̵^>.ÒDi,+px=E&Zd! u'dkfr8V3Zߒ4*(Fӱ͘7%%y4_\iE?k` UӢ~yNq|9ʜ=cė[1ƧVg]ٝٲYI@>f>"ʵ0`:gR\we{f r֭ͼJˌd :Ոk,9k@xf>JFKt aF>cF?{RT#HUɯ/${B *8vПy{{!FC*9 .sE9sA0{$m}kkvͶv,V$kznR-]>䐅qY Z|Jv ";{㰮.nvzW$_cV|u砪*dGbvnKtѕfVuUm۝iKeTNuԻH/q}^w>ư!d7Jq\N}u~w+ד=J妗YLߏA3DG7c-3\"j{HW/O&cG=qVmta5Ei4ͥ$\ϵu|"z^G-3r,4Y]}<ziP[=ϭ1~%Lf<u4 eS*5͘_ZE]XkwF~`1UDdp{+`p?>^G.+K]y^MPV&QiZM Ti,_J{"/Oۙ>'2ٛQש>3>}\kYsS@?kʖRW,}& \G=.JL?Vߜ?:FƘ9|3)EKnqfAM~:5Kc]G jp>QPaG؈n$tTCֽk&1BEվCƦ'VԉվOӏ0Z"<7'"{GX!9>n60ni٦!?J)FҊ`ZБZr)[w&#^d7#ukKkxp0 kϙ/8!PʱgS;`,34 9k>0O"%sAsy2K+ySUs\}rj9PkV"O"Es$yka2jOSڶ FqQZY&H%);g\ z9af2i9׏f8^O=)vLʆdOһľ~1֮OpT]gd!umiih^`$*sf,xo}VbN7&4Գխe?<ҝ;_!],f#^BUO"{]dt#,f4 omdanzEArg8E:25ZFPA&u+75 :-``I;mMX~3ϱ[` ȼG2*7^0qIi{f a>[~ iq#E#8! tvzݝpԅӚ1Xz&u*i&$%'s49cΪr)C3u$GJeK>tf>d/ap=ApȖyjFO`YxOnr>R:uNI N k$ >p 2)m 61~T 5$g ?(51m#ɕ*f2-/UU|6duu3sMclvzxcT(4Ҷfi3 dF5v֣r~ju?ſ$g לwD" }$?"d|îlʻr{$WE_R{?< o&5}N?D`2yڅԜұZ '/V9OQDթ|E?%HohxQG֯Tz܊E1u =n3kKhGP= gNY_yABACHSe<~52ٚ~.7q~ub!([F*Ǣ}y2}%o"eY lEx|宙{//Yܿ-戓>'r1zR{נύCbYZZ^1";-$vG֥y}() /o>/5}O7֕I4Pv,bpU-% 𴾥\?5C? \0;Չ!rT+^:RgW+i)%<+\VĐDz0Zoߝ_9g}gIS@߭tRjV}kЬ'r$M,#H~_{f~ xdx捲 |H#v֌TZ+sh 7Fz_Y5nd6p r41XwIw3][,$P6/5m v4kRZu/jKs28C up WQ-Ɨ< q5 V7@9Mȼ]8wJ7#?:PTּd!H8ץx2x4%I"x;1޸]8.Ʌ;#ԉa*A_rCL)c'u;[ ,l$c 0g20X^J0:.5Vyl@#U[4vq:׊u(nu82z۵R܍edR_U]95FU x(C.%]X \IzIi)F̰`I<5ύcByڦˡG=>G%r$9?O|7qz 9Ew'֙}0nv8e&s˹F.$7h~3P%彔{dvBIWEV zzVc;Dcg*皫6 at7EB_jmpComaڵ$11 3c'^ f$ljRe?gm_ZIs,`mx+ a1̓)uc6QzpYAwu*QC G$Ow]n'ֽ>$!ck]d*)^yV.kվ"5\?jqn@J#Ou ePz0TN[NuX:C*+N.u'JoW]KOk{c Ҹ=sJ3n \҅T SkVsǭ-"}P1Z=n$2mَA֭OH^ ?ukfv=>;4(@_[x' ;Tz ٴkݪq܏de`vcwJ5X9]`'i= CΩj45I~a<@`fjZX7yepx8=Zg(tRJixy(=X p?Mh&jci`*gJM)&=8ISk{S"۹?^]a#>{ *pM֝6 ǹ;e?b+ f̈ j_'qS|t Tud~5R8 Zs'+[G+5+B=ƆFxjd])mL ?JT|Yf##vG?jtZ%##Y#no4Q 6moQSi *ц+ckc!Vq8*Q妃Ȓ9"QPTee}F01MV$JB93$v=1Qۗ]1p3hVvMah0\\4O" `ǕQT ƈQwLHZE;[;KoՏSVFnxHPzRmvmNx@4nFBݢɍ*5<Ɖ!}bFrMFpF>TZT**|-k{{-LKbD3}v2{ӄx PզgiUZ[᛬r:ߴ*"rTTzxk9'vZqyc+UcJQ.i6 h1,esJޝO4'$SN0oL2@ʿ6yMT ?3R>#'{Ju'Vj͓N(k[˩ԁWعO !Y%qT@B\z*Ww-Oz=kEw2[\HbIX[nɨ-ǁsZs;Y241ݑM[OhGXǀT5;N<`~5~}̜a ma q`xEMZTPOl]+U9JM=LbkC+k\yy:e Y~UT1BI;@sN9c"kFXh&bѼ f ڃNX`ONX秸7WJD ;*+?P-n1M '< R,H@$}*GbOEdfv %;:dens8'j8oc"R\?h#+Jۖ=Z{Y#},xRy7*YTim)|q, 9w# u@Nֹ*;oz,0=6[UdYwс&Gix2I4GTm$+ ĖO,v:+GE2QDg$pjm$o!V N:OoUfs4ѓ5;"rBk} 5yC ^I6dCJѷ:ǧ)c sK( [=>(? 0iX#ݴEyS+Tengީ)^㊗A1QEUr:QQFjqGSlȺ)Gu#?ڻQT7"МB>(Ӝ5R_$<5׼Q~IXTG)͆e?{TO{r(P93/FEģOG1붫<2vQ!ix?48=o!͠jSupѵŏa5#O0Y*^ndqSIw=gc躓 *ˤWo|> kj7hAtQKdۏ\\Bm&YD?R6~?pVp/CQ>kPkz ZsP1ƥҧ߀{jd}GZn =1q[ߪN c1Bs!߀OLT\sD x@ʹ?Ҙ"J Oĉ`sAR 5u.[”LG՗ ̿Q5"F8Yuth:th_a!qd^zWF5M$J($/^aY˞3sHhh 2tNKKO~ 5J!rNJD,N;{u~\?yާ|O}E?6\m?>fJT̛Ps?`>j~]/l3TÂylU,`ֺwNj^^_x r*`=N)HISlWdBPC Tm8淆ƤߊsiQ:(2l$$7(VҴxԘ7KhQ$WϠvCޢo#󮁴'D47n}Krcqҧe<04]):j1速j] 4X$:N#ơ:NdEI鐿Sy/P^*@[ӇXƕR`e<@ C>[?cPgE*MOrڋO@B2ÑRh/I94( QbVaf=!5FZ6:Ju~i>ɤvԤ?>>w16Ȼō;UqΣ&_m$5 됫MQ@k(71> f Wj}v/<'ZS2e9܍Ì%M+oR.n{#*j"^>9#ޭyZFM#cj9v'=ʻղw8Ҋs˥xO]λ/nDq*35X/Ч᪫.I_’w9(y:Xcڡaʜݨ2 i )mO1Jl?(ԯC K/N;P@~zϚXc hWWQ)uTA"?>}iʞ.IJLh XzZ %IEK,))vҗ$}޽h%M)!$8Gҫ #j?-! AԑK&*HʊkǚwAZ32OeN~"9Tg ?r2!)\-Ɠǥ:cңC*'"*;ѐSAbF~} .rUŸ~3 ]'dvdXS?iQ'4pp3RvF*9N/AKr~V'f>Ա3b+8z;;xT|9lH1}j)>})A6wœb#"9b*,P!1`)Asbl4Eq5;DFE:SvP-<IH͘Q&J(F /i@ZsV*$0%AT,@ |Ԑax!h*?*+?/Z6CiTxSv'ǥ9NcQ 1z jUp@3/GO !``PT[w*O~ЊꋻʦgңxRcsOE7PKZG'oh!n<}Q&1D?%4>B#YnxZR_XÐHQD{u'摘>Lv$qja ^H4~jDQsUm "mr)q[ Dӧzt}sPdU- ܨMWRz'O}!P|zSd8Ϛk:"lɫ`UzJQor)Ip{qRb*9ZT f]flSs9sԽ[ CC0L-=nr3$Չ"օ=!0e*!sާNӊwρB!ni m@t$1T#4z.p>Բ7Vᩍ݆^r\7by܊hl'׊|tT72=jY-֊cUXW:䶷DJ->J@#sҞ'5Nabf a]áTc^/XZpRz•Bl-IWM:edCV}~+tI$;qZs&2M|5ӀğN*=1zR޿|3&}JL}Utg#œ7z}ir~̄{>ryj 0hAf IA}Se9(si{/9K#LkiHGMNdir ftk*zvc6} kO#>&";3H8Rs-Ss.A <: [o^sZxFK~љV*GU@FJ\7'oΟ(, )!'1Xdas/O.Pzmyo]x 9AO^эxsȣl | GsP3a=e!y^?\l zԤUnsNy B:'X,S'8LPED-nc@c`KtҦ6c8AOH39ՅlAN6v}BJO:J[Iw"+s񩁠6zR53ONhc8>'LFI9GB?:\Έ±QAsRy s#+"6`B5gnV,xʏ—#ExZ'N9aS[Nf НD9=iC0:TMbH>bK" )QɫX'{AG+EVf%杜tAsׁH=4}zA;怸J3צ@?FISupui})Z_P=>vҌ;YP;җ:o?nqހu.=ʌ֐\ P?3Kǯ^4;01뎴3s ,Z\89>•zB}.G$OZ,F@J@sh\1Fߺ3=/ ֦s@h\޼SH$i~bi;;v)IVOO=;,i$RaaN=94+ xrE?RgNr2pc?'u昮G)H91@\98Gb3#~Ts֟ZLcq 1SiZ,!;o0`:}NJ}hH.Vlڊ{baqxN*8##=:ӵPSO)9ǥDNr8 ?)@x}m䏯jwN—#Q=;1ӁGwz84җi9=G@;tug8v/ڐ ix'OZN@KM"G4=@AךL;sMl9 )v4v>R} }qPRpxK(\(9?JA ȥsJptr@FrOl{`r~;I^知/A\|߅'~(SXS@oʔj`/sʟ ?;^xQOҐ8!OZCByZQi3ր ?)a4tcsџ9h==.y' yM=;֔I3LΚH^}3ELuKIs/'`7q^qydZoocHOo˚q8$z@ ޗ=!$w,џJSsH^gۃbdINicJq|g'i鼃N❂玜SO៥N;zn㞝{{v9w'󨘁AB8Xw'c7'V5*XvWVʌpq*G^(Wz9Gp=:qH NGBA'O1sҐ䎀Ӂ=9ϯDgׯmsisC3z8g 9'PI4♜sO#cqFz`Q>X({j^8QqM'H |Ԁ:{O'dpOw (;>sޗw==˸Q*g''ʌ_jfShN(.JSMܻt G9ca9) zfprztKr:zHM~ N$l*aq߯!ZSr*CpP9z持9ڀ8.H=8'Eǧ! 8cM KOJ3֠8?y4\z9^20=3h *o.8Z 3N(ydMܹzgt?ZOcGAb'I?I=r30GcGZB7ZBFHJb v=HNW'&F7cPSNy)wI@.7O\r}=ғ۷қ={tH}3M>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 30 0 R/Group<>/Tabs/S/StructParents 3>> endobj 30 0 obj <> stream x @Dnn7wB Eb(Iҝjaf =(ҶjjĮ證B)fIrH)5d+Ex<_<طfM2Ƨ"hLM-7k<7j\u4\kf8]ƨ8`ʿs)k C endstream endobj 31 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?4ʬ"AR">(=Fn=FԴAR`zʟLsHc~TmPeG==SM+@?*zaQz0=Jzʔ v(~TRR- zʗ~TARq?*(AR򦎴~TRx'򢒀Ǡx74f?*BGM&?*֞kiZy;5x\cOTH?ҽ7w͚@Ŝx«x?5Sl=L$zʂi"H4ASI&~TdzʣuH cO=G򣰢ghzʗAR Z`'~TJ&-%~TRP`zʓ~TJLAQ?*Z)ATdg\Rm  ʬ 7h@ &=Rbzʤ4?*y!eA"AUTN͖>vȹE06|N0nP)7 NN))ؤ4AE-F2)MpF)@;R wjLSiRZ((Q֖:QEv4Q@Ri +\xs:mR[ے6['-Cbv;k-]teT.ͧCmVbv砤~i6&M!jzeodx敮dXA4GS:~h\XߗzZic)yy pq) pRjP>v()i(JZ`QE-RQK1@ Gzu&()1Of)1O&(SH4hRNHz 4yi0M0ԄS FҊV~PҊ; Z^ԔRwEQE! ZJ)zQK@@ J@-Q@%4ZC@<vh!{QIFhM%&i3@zJ3K9ȹ 2(Z]-8pR\M5km4 SnզLxR*tY:@]_J7z $fUВG /SMP()@഻k'QՅŻCg9۲);h;pEiw,%G/Mޟs'[GO/Fޫ.#HEܞg ά 'QҀ;\7ljcP7gڑUwI];?haFw~\SQR(KAKJCҝHG (- KJe(1 ';SIWL\Hw~=zk{wVT2X$.HyXP:w9."6i4^K1k(D ? oj5f͏ Y7 A= ]=5{ 8UQ߅axGT彻E._꾟Lķ76#RX7 gqޘwde\]b[ԐSBk?=w`^Gy(匄O]Cy.h^ҦثsĪch)3W[˄bTUY㗒 z]FH =jS|ڔkA5Ii2JV*g#''%hēf>d~(ɓ'Mtю{XI.Wk,{yc+xn#\cRF/䔕GQִ'o'2TǮoz\C"Rx" )j9n!KK*"XVVPAR2EG)GsyoeMN$ u?+I&Ƥ zV@| 8zϏPK޻MU[gEӉs9<%f6Ltˏ&3,~Ʋ.55臕([O!+3PoC!j3i=3Öz}kkdW(acTg!ՅٮaҺKi$H 3ڹ{WY'&Vh"10ǧ֎kUF` c,AU]#Z7|L^&z7o`TP ^F !~> yI*ꌖj2$6]Ԇ㎦qcjS%" cua}ДmTb> RF“1[o} :o _kp wL>v>zXdX̭ =9zNs[VbL"]tP);wtu&zդ'+F ~t\,kM"HfC [0(7&s|/ R SMhԢ P8h'z\PJ1AM>OS- /.IaՉ .FyGK݆~m C]a~Ȩӗ'@H:qojpѽ[I1@PנoRT)!+["g6-贒)f_ɞ{ի{K孟PY;隷$I~Ef!~RG)yWv=L-5%d >UmkZQvy3ƃ%*fS2s0-ӮOe+h/Vp*2L-uVv:ZMծ:8MZi9“hc," QwMu%N)#(Z1|Cr"2?ڋ-52rs˙.'u.x1+Wúq%mw{f5v'Q4x~Wc#{OE\WUycg5D9%NFjF6np}H^t;-Mo.q-mmߵs!2"(giǭJi%g+LzU2vA}GZMGHOXn0%0G^==|Rr1w#4Mh'Eo<:Vf4:Zr%Pne#1a##(8qF10A/Ukd^Jf@=Cr?8sm IjюU%CHw|K<[]Z[[ap6\tn)[D. p}Z^R՛Vvbrc M¼s.7!`3֗b2k*w(8R[*F_i#¡[ʭ2d_R r˸jKeory8:Px^[d+,i$ynPx'/ܩyO/ȶ"6#i*Mv#6K8easg4a!$s$<zU5 UTFXgO['G`#I$_r=42T}3TP_-n nVP0OpI]Z+Fu:MNA䱲@8')u sWѴ;KKN\&r;{sڦ۸e ,|gj棫*EP:? Vah4vWAل֑A»8 [Pj@6[L8 LȲcztVk/E@mb&7>y9N)@حcw-Փ6CO`:5"H#c8Pq3zZ}ԘQ5b*:dK|F1b >#4KqVмE\ݤ"\mc{s. XM9|:$glL{zVLj㍈oSMZbl"8U mwgn Tשׯ91CBΣ5{O7!ƑZn;,am+HKfX!T 1XkvvJ?¬J 6-c RFNד딹TH͞k;9(llxg[tk[JۀA/' .l@63Ic`=ʀO g&1EDd#=y,ْ"u;{r>Иڌrrzu"m{F[&]+ב\xHFQXprkNJ3F($u[?^R19nk?T6t'l'h[wk+6-錑UX̠!98*OJıgb5nޭOެ`)=ֳiGGZSMi1:}59S8ìRyf$dc6%svntn2%@V,q¨'~2XlHa`W{|A)6bǧ[%rٙ>޽Jmaȧxȇ_w[^lH:Y$)r:coxR#0y q޴2fIr|1]^m䷜#{"r?\ט]'Q ɽXʨe.<ޣY-Yb}:sNq0 zP)B\Cv621qiOM7p;B:"H v4^8| ֕^-.<2zcѰ*+Ή3T(h$z*U1Ӂ[r.bVu  Gq$ȻY7~D"4,>KYXdx=q>\jA}:|}͒\.BpS>QYOLP-_IlbPA@p}j6rjQ #kFVo0me+ymGBrԙ=yҮ|үZ̈QG늯$7cj׶#CŸ9^zZ )琻y.OkOFhaye_*s2>A֢>, $籨\&`0"0 TFbmrL%(d OΊHA4Rb$A;Iy#q*E!WXtKg%ZQe ac3D$749Z)V ־ &㐘ט" 1['ދM=$K,j3Č ]#v.>=t z,d2.~~Moj~MΛ;`v i{w8+k+& s:I#! X*o¶5>uH2G;#8eOHm5Gdy.A󶹖((Y3>H쌾fsxMBk{&;Q$Ut3.Ȳ#՛|ҩjZ6ks1TvۑU.`Ӽv*kZVh.-v2X&@^7C{ǹ;I5|<\ka=G!'*@8`G"Z40lg{[*=;TQGQ]'lf>n\WG]i:\j@[Hb@QΠzrdJ,TԮ1ԎzͳHvRN1NR7|'U#E%cޞZlF(H'Ո&AYrFq銳;X"ihU%*Wo-9i2!^}q4o) [@XR6Hsxj1s#Me3p°,vڍě8Z< \p^G{`HHvLԨEseKVf]Ðs{ W8m)m3V+wXz@&NAZTTJnh`jM \IWVS3ȹ)iq$+x<25БePW 1"͝PtZNw,jIfz pbhM!R+IXR-5 68 @kH2m+>Rae`dx`Oz*No?ҒRVڰHG'yv<~42|?:wR%stAa]Ǎc*eHL;OnՐ(FA1]Fsk S|5\>EexK mf:nTaGQ&w1`}-Y0Bn}0*eIn76>uW\@`q 6jZ#_j0٨ dױr,mJaޢHuCS4ŢF^P[ ȪH^#^]_{Rt%Ögǚ@!Bi4+2kŪ0NkH ̈l$vHcgpPk4v+Tݵw3S[g.ir1򫚺jRCDrN@46anbPD}j*QY#n;`2GGsE GҮŦ[O X%ON+u@6vg>}ۨL}ҳqCX7i:IJl!=}(oo E`=g[2–뷶}OGx #Wd#Sv&-syRM(sn;{]2j(1 ++v5lcOMImwQLr E_Ěf]'崚\륱L-*ʻTGGZ:_RN]{*4ˁʝVއyոlUwUف3wճm{u yP1EGbΊT*M)sdC/$fTc~u=Ī$>goo[5~uhP Mg>pVWնJNNVo_G8;Tw%;sn(6*kg .I lNxJ?Fq{| #''ҧޕ-KwPn@=:蛋bB[85kX%{GE˕ReajKޥGieX0 z^*l}[gyuO?vZMo,degPH۳}^{ ݙ ^h.tS2 m!wq8OYY)&RB \`BvWe|qOn:FFvo%I# zJ]GEⷆxiv?JI=CUm6F7ڙ_9=ޭiyd溹-ಷkXg~9#C( v1:yek|gi{^T8pw7ZQhr<]8u9dIJI rmroEQyM{h#2}}6YUj9:QkDtӒ3LnmYO==UbY#+=nRG'4Q]PmƠ*zh8b!//V7[h=JeNKvxB!!͠i1; )?{h@{nnaP--xq1zjFhmIdm!^qr$c1`҄d qS'ýq'H83@·O47ݥhE,Pg=ꆭ$)10wb< pŖX dq~:Vύ<6!X|ȩi*--RXyzU{U`rB4Htdjd$'i,ylz7nj7~ xz%!F wHǜןkWޛB߻^> mĶquWho=[{heeI-!*ԓВk(s^ *{;$pEwJHCuڏx}9Y͞Y2`we&xdtϿ-֧{5d œܮcM&aL30ʚx~\nrkg)t+F-6]Y(׋qvQ_!rmxXDO370r2Pz(Քh$r,ej̭5l^^E.e4 j_Jm<9u&wb@cyMKisCFKE+[F +QZ / awQdԺ,zM]*B֍+{6oSVeg\n֫izW+yO,w7_8A uz=4M2Ȳюr<3i^R# O֔egR^eV[$lh  ]6@a1ҹ*b6y85}LyW뻧ш {~R{}k<<S4y?5eϽZqqQQ5Drڄ*-'ӁW [[hc xGjԣE浌s ˰R1i$J_{qYq:70 ORrAWڤ~Rw'b'uk洎tcNf5QEgsv5N>SYw! ojk봚E;ڸz+[B]Rlzx4;&@qNc8>C_SȢ:Vb8(EfhSJ:LvźO7Ҫܑ֪<扚,/|@Иvۑz4w/Gp#YqWiY Qqqt? SeA# s\J\(.UInE#EjUd]u;K{Y˸D\sd9 cT 6 p?`^1iI5`T" ּSA^=ODޗYZa*2ǷZxlQ>" EMF{c1sECUKNio[+Xn B xFA8XYٵ q缷kUuV 2=2*i V߈5-/^~oFKF+c=J-'b(SӳguI&|7p5BhKxG>"`Y$#o(7A[?{EKHy2~:v|'#ocg"|Ŀn@=hZ3ې:\)f]Hp:qYҒS9SQj @v䞠|=a %@RUצ;m6n!=6.ߞHR[Umܛea03mU'8TʥU{}.p?ɮx#.krmI$v\O=9'ԁڹČdGJڪyqz.u`*jh#0I=OJѥ&4U8*f9Hb@Y{ԶPF/Iد ̶Q!niyܑӥbuF해SC0ƻmnS%Y[oȌ!w'&^Om$6yWhiPk-1F= Au+ViBq =G\XekhREi2zlI;WIsaUˍc-+U򠅉bgcN;1ZX*wºfz]ț"^6%בL|6vw=Qohgb5L_D 4z2jr6- $RlAEG26TgkC XdI8A\o4.޻Dr}+m5%"63z|u$rjƳ,ĻesVT+ٚէ*@,zt}9!.+VPz\'m-M\:+LWqT Yl`<+ޯ^|qKckHZnyݑ^/44%"\t'Һi4i>dI6,k|'t45 j 8*si^Zs1 Žwp9Ul3Pd+u" (RI r )E5j5įrB> avFд|Oub;KbUurw5OMjݮjV#ߊx_o%Z\a'tqVeKr<~ȤV-j䠰mM#P~I:JAW57ҿ 3Q~|~5SWlrڕ##vk4h2>*'ѯm@%1-[ .'9xI-`HቃmRszހ'ͻpTBU+)+$r:]< K9Y k'/Dq#u?+/.ASY#zXy,R1Q䐣߉R{*0S<9ues2%ɜ|2qsjּ=[˸XMQB}֣"yzR1|8AۨJVԅN{O< <O)v蠌g^xz>O >q;8Rƺޱk<ڱkypҶ\(jNZ>B j7~[j"ӟOmA 9,bz~"g̓`oP3+sLOm.{}^ztu#ЃTr swg vkqXG TVR Pܞ sxG]Gm&%O +pL,qHƭ4d8-sgÓ$ A^}OdIͭ'(\?_z|U\j,u<Ѩoº]K@-4vQ1ycN7fEn | Vֺ)d{~oWmjZ]ܗc_j#([ 1%fY m;Ix{RO\JCgk6m'w) 1y!Y" 5sWJihA՛?O[u"NsRGn"lHJMZp96>qIߋ(+5XFx1= 7%sMlOassbq 8W|131NN|؟V[ voĒGt"+)PsӾNjomE>hזmÑhL"`yl sgDT9)Hb8ulc!sk*gVxYX-N~5M{OǨ\Ǔ([1ϖƔFnwnm#WV[q@t ~$ڣv1}S')mʅL8<[M;E";9QJĀӧN2sT%xbſt h3>>C~%"dPO%[uW$>j)Tw*8k- b+rNG|GOJ)\RI҄U=LՀF9\ cWg~bֶbFR 뼾knV.ʋF<3횯,"39֪ #t* wg騭WL. ?j=XIMC$Żvl$m±VHއS;Ii1ì涯u8CHk.:+!n6tQQJ@ҰpMn /e6Ӂ*.݀ro~3MImOϹa{}潝[Dg:k6|q]%`.=-#y 'Q{wYT6Hn)%#޽)8y/ݐ{V6B|lr1]׀|#lS̖F>J/[1{=>դa=)R|ƌ%E<+ _N+,os([Eze?ppݙGσ|+COvqb8Xt @E+Ök[oC?ĺMske:ʖdH)pZθ8qcYQf6%8>z7;i:mfLiWe8pAqN[h-rēI?S^ K״;Fol>^Iˊw0Oc,yM49 LyW:ֹERLwت3 Śg2@*95ΧFir̖_n*jaxrKEPq֢KSXIjY2 .dflNr:<1g%߅Ҫ f9+>*`AKAڣS[ ˸e֥5kMO?yR[i*BrU}mE# 7 K|c;ܼ8ǶM`j: J;)56 j jYvݏ1*I$?ʺ)%+y%Ewcu&c~0ͣ#wpF{^3m*O*H6NKF{q[Hj{NDq3[D*b.^AG9OZSw_xx<9~o-aG1퐜uq|A-ʼnb~CB}Ugs=9wȆ&'kǚs Hj=ӧftv-E#.}-G򬺔dv}FxFIl9yLҁh cd~uqRͫa'J拣4/"X??vSCH[RU?թ!d;un. qXjl[meoplu\H[#ZMm'k?ÞR)naV={/ / ;>Xm-V7q ⮯9 "#{9҂ؘ*tfUWRBݮһNO 6#MimxY(yv.zNiln"!|z P&.ٙ/a2:cz8Ǚ&ySmlq d{ksn8Jv^AT_-Z ]rm|FC>G|nxtj i 8q(Ϯ;qWR YFrx$IfyHC5Ffg5?ۧmr+(\Gv#X{HDqK?]GY}w) DZkbK8 =ZuxXuI.l ->Y`{`pJ淩KY|Ж&u2sF~9\:BN8.ǩRO5V $r\r-o% UsUJ.8@-kNgʏ[As=89= es˜8r\ǣt.yrp;a?>#9wq^ZeojyCb/A[H_8 y|W$rMI8Z{99KvgѠR+t5sì=%khT'' 9vJ6q]>:]G]({q4':QQ_ j*՘SDaLϐ@qV̟\toX7ٷNhm{ƛsvkbQ'`|z+Դhͥ%zt2D}s\4]6U$x9R~WfٱYUNO5c%tەܩ`5 aB9={ź T1!74Drw_^VZt-$jX0:ҷG5H8C<0* DGnM^ʦc1k[建Pj$+ګ>o\Fd h1b[/%kX?9n@eu&(@wҦW;qE#~$.G:"j9sʦn{9ssk6dlG#JҬ3 9$hjr^*bA3[G#|ڦm=պl_[^t/dai$Py'GQgȚH)YY1Ij;;R~O{~L1Oc뚡%^ܾ9@U[mJ[CS4kj$쌋o%IsO!:otwIe-1[YGjѓՋmX壶p:Uu,+ rʹӟ3ei9UW,!OIteARZANžkmu] wg$Yͷ'd?.a~57Zq %{DZE|1I£l5M46@.K .m~7ݹf>9[۝CRwùuqTNؕݕns,U #9*ɨuzLi 8&/j/6%RZl, &$}RM# Q2뚨+SUeh+O}@ .'#; c߭ix:Wgdn$^sAo>ѧiDy*3@?ƱFd.֧=u ,r#?89̖#sfbA,#`|Cm=mi gp% pQ{fdշiifۘA:vgU&݌䒸V+5N߀z<"DʜqEkc'p5+rXXkν5`6Cb|s]6ǵ8$-u3A~5Bِp9jK"ԟqЎYMXYjάU;oi]X; AyaڢyF?)=ڧggmMߵiFPMNUNﵔPe;eF^H#%2{Ÿ} `tQ7ԭw/ڤin^JKX0JAtq!GQiaz x_ĚnzkN/=YAf񂢒wnƺ(|\\1$]ʢu&ЙT{$4d}͆޺d)2:[b<"IHgh\A /bbkjmX󰸕BNvO6Mm>oHG͞CZ΍j;c:<xyjݼrj&B:ֳTy]W7ukhC#/5IFo@3ҡIax%L$K|Ў|bjΈO@;a.Wsju"uܓYi!2FOTP'QiB)U"|,*ުUx $M՞3Pgj^#״2]3XnXF"RP.{n1Oc<ڵ-S98f}W2PVf_ٲV ,yᄬϵ t=: Q"xտx"6l4"0Y]C y[+HR|rXsP1wltY__< idœ ZýG\I|14Ʌ}9]hjyJ|9h~%7cC?d pۉ\YS34!)&,cϩ=?LTz'[ݒXFN1tZ \RFN0?ZqRS/V0j[XK>\Č䟥t\\yg%$i\-NM;=½þ lg?y>沷|·ky=ԼKidi̊ʀ~~5N8c8I8ZXA[o_vxU$yY1$Z['m\2D*8Q}*j#L*M9dEGf*ZZvj:TP2\K%BVmh;[ܫ}2=+*4ΜBFiU +,/-$ciFA^]5}u!h@P966,yhvjHTޘ luXNUu;/V4rɃcZyPɪvْm͞Z*=*NhcYңN;tJn\MҟG1/ }">4T2B&NɳZsp>n DOۏW}#U$?QQˁjr1?6 dM˷Uǩ,>yYY$|W91qnWd퍵^o,K"4 1xTV?.stk>G"ZYSib#X\>v8Ȫj[u*Uycᦾ!i8Ө)#qo_]OӨNW̞F<}}1\YK=ΗQq1Nyfjڵϟw-28vbqNjF5]BGt;Nvbq VQR`ѦpTtWt'曩8Xa11j œJYT~5O:tZm M>漍Y6 kJsn-NiwukZksjbEhR8P8,:vOF]OMqזLaLhp$Mut*tJ7~w$R%¥q}YJ2e+i<=vR;YӮ.Vm[VY\#,t[-GLKImIe3$#9+ #`U^6OGV-m~Co{ t.: :d:iZ5cԏHf[xB[;QhtWt%#l$޺ Zky.zr8nKWI)æ{֑c"'1'f·01V4b- ;GrOjhP JhߞF ;kòqPLD*8SJrMrG?AIsz)I1z1_B0ps+"dVdnJ54W >{6Ec 3 mK7weoajvFĉvja eW_"Rvx:m#+[!椐$@&eTCՒ:M[U(͊Z#^D:|( g]ºv{yq$we!\L"YP+(I1osp/݌̚a.JtsesI7)qMi1d=RVMܴBe+R@zRĜ&s×IKD0@žс^ŧ$)嬊en9]$yxi?m>mss3Yty;Ag֮_nhPep+{IDmn'/+npfU"m/d/$gT+ϵQ 2xx^NʢZ)﮴uF$(pGQQ8JFNEbE&7^1RZ]u-ıqcqN}ebZO$hTHe.kJ`YaelW$rYpOh.]|[Z4b[oq`\뒳wQutG&+?|K4cs> CHԴ&Xve[zdTy#U{Q*TWҖAS>\[j@'޷ɕF=,Zv_o/CUԂZ:p ϡS(z錮xUu0bNseq+EUѕ`\?خ|*1+)1QGZ%7s!M% g Zn54!̣JBSe'-0tv3.}Mx=BOdz)jFH&Jc.ԄBH#XWF ݚ)UuWns3(a,MYD JЛKKGdR==}StApw C{RML,!:8眏zPUdkY:ږm$0!7,DgVSBZjaxGNeYW,}}+_T}c1\SE6]> ǁW_e8Xx֢\\ܚlzVgwמ[bi22ݍli:ͨ]l&PQ#d'qs:熯4KHen蘪9ץ&j7r#p>RdN껽Γ[k@ZP[upҀoa\1XEpP?J}%Ə5HJMQرjMVC4`v%]P}[FT\ȣM2TEd?8ZѭdRA5cz)l5 (..,$V'==ֱ"ӣ嶖`]]vtEZ؉Fdŕ0I cc-Ϝ0}KZ eCh֪ڢ66'JQwrzMS|: εȚ9;AW Nk Qu<`1rU >)NIXʼRoK4G.œi 2A#VDxǨ-WDfϏʲK_ nH޶HFd| _jfajx& 7:sz4>j2kd9JoD?֡4{oh].3hζwaҹ]1QY{զv 5xbN=AVH匦zg}})OCT|rؕsk߾hDf? מ^|9ph?i<~rF0?vkܭ-86A u V:j3ɿ,ho;A2:^%r:ri̷-w% ɰ99_aZٴ%tַ1V3}P 8Rp=1Xk$ɸTu,91\Riڝ8MNgˇ9?bxNRYy~Uo@Hj-pjDBN2Mt>\zR'hxOM/z??CY jSSTA85&y-.B%$O*fS[BLgA+*>SZO͟F`{SXyK ppEVdũ[9t֊V0d.x>$gZ t/-0 AK4LҰƕVN?{ϱ]7@8QR5SHnÅ4nTM 8hΙcf>'S0`iaw ZM8ƞ ZS1q4өi>NJ[z#Дwer8kD:0&yl[$g#Gc4>=L1 VU%ͩcdk^ZZ7ocӹ?Z5J5v ~r:f&Î N=+X5fɆ #ބtIw6 9ssV5ζI`.JHFWu?ҹ%QNzcgEF(OrbNԮ$1[NҼ2O5+]}Iϛٍ8ÕDCr#AIl㊱;Y?Pjԑ[H6Iti3ѵ(lcfPI`N({6 .W/QUŴƐ+B'V>vW3rsM"Sw|O$ E\ql}Nh=fr۷ ,4uxd\Ψ=Xa9#̯PKIySc2p"K(t6w\׋TQ2ַJI&x51/9=Zۛe(ȘAߍypGҬ5GZΣԫqF8' Hᶞ4.Tk|*OfmS2q,CN)F^GEKe)\J`V:J&GG0 qN;uBl-m!xrTrH'ߟTwCm8rClKy \Jb  ]tzvsq(?6+E%Y <晍rO2>0G5oEv{ə˓sXTt{u_hq @ Dۿ:z9#~$½ωZŽf~ Ӂ[^d nEY6р#ҵ+H*Oe+׉Lѡ$=B?0*kX,@$gic$H7$|H}ZLEʽ_,N'ǽtϟJUf߈|@n,5 ]}ׇ272D~YkhPcup{1tU b|,m° ޝ1cQ}M4 Qn*sgn^-fꗑYC-@G>3Z^Xq9TơkqJT;@:IJI=/ԵeolqTyȢVnkv}jaCvI4:K[ UeO˚L|py%̳;I#rXԚ)Z){<-4tJus GN K@ I ֐VqF(TAM:|.1];R)+27thªOKJ %܋yqKd܌(eIM1 +M*_q}^Xkq@wW;잞]3NPU8|ZBOM/nn$IG7sƿE޿?QNGe6I<:эYZG.*AJ=Ŷ|Cpr3gH[HzW~hn#*w>y"{P a3^kmu<-j~{];g[[.F`q1/k.$ծR1KZ_oQ$ݵLRM'8t5c\GvJ3YwBH1;XW㚡ɭGp3"FY1!'ׁW{1\n'\*8eŷ54"۴D' ¹[W/nOO{ΞKa1+Z=9+#b'VE <57?5)az'$,%h9V.*8S$Icx5}+z3 %24sl@{|U活 p=i0=zdV+CO5~41Y]4>H5JŶn6:Hյ.$ ^/ָ̂`$*ݹ+׼AwH iUl5Eš09^4{xk^M-܏E4'f^gUPɌf#cNRpqHyFӜz=[Ldk2S\MҝM})9b]Nc֖;(.(=PҀbCiJ^iqAץfg恌nڰ_qYbBy =5Ɋ)ە*733FU#jZeFO4!fo=" hR޻)ӌ>pի*z{V">BY x*'KYYq*Crb%^2gf<'y^CBgUu-v&[foϫ!?ffc!O34fIǥIƷ# J݈Uqj k$uąG%ܐ;g*2zrxo#lu9'BK }FS.!1cO|16~C$p^;"7gc 22" }85VpZ"m j9L|cY3Tdjm,9MyMtiѵꌮ{zX7r\X2[1[E+1q 0Vӱ[2Zs|O{gSޣvƳ(=cnq5LTSΜ=V:pWgb]O<ѯ&)0iOf\š*U1)pvZ yǴ@BL>aU7ީ6w}V9..pvT,@$;qqwPXz}iJ9s b{˨.hQNzH2WOq=*;X#/qk4VVNf9JB8*jI&2aymX+?* "sT,ZFCob=r0Y2ؘcI> 0CU=M4nsOtdY!;f'3nx jvc!,*^kY9 @xs=JR^#2y7TZͯ.gn%ΜEnO}t񴒿EWZM U>c.W"`SGA߁Nd1@(HRJ1K(R韭/LgҌz~?JP@ ǭ&< 1E(m@ <Ɠc?^c~QJaQiT 4DT cjaG\;y$8ې2xgIl0>iH|Ȋ &tIj\sHW=~Tܫ%f\iAWj8WK/OZEBҐfk÷*N3'Wa'xكjVɧ\Moc/;ƭ^VOy_Ig,NV,c7w4:]T`2,Hz9ƅmW{ n[zvo8D){E74iZѦةۓTS*żRrd3,@C5$uدd԰u)ޯ3&jOV?]½BSѮ<~=iTF:TEVxIzHLFXบ 7."iͲ-K1q:ӵYP,ɧ.%O,88اߕy֝Y{yW>Cԏjp!R/N:oĝ=\M? um?R`˭|eq^ OW5xG`IEL)fUW= yխM.܏εY_hzo.HLr 2Yj}M9觰u3 f9@ Zmi pKLAJzazG|1LzMMReFxւ~0zUlzӷsK|1"b㏥8:S@gҞ=(sN=hzRc߿4pǾ)1~ 1J=qǡǯPzр1Ҕzc4c㯭'_Z6}?03@ RG^}hxri}8F } 84ր(JGLF230sirsϥ98M ^sKg?Z{ZN!IH܌`w8=84{hڽh|yy74yzqS9 `gvpxj,O *v"$@Rx"9'ED%Zt#m`=|؊Pp@ZT I֩gjĕ,NIy+CS$9)쟐1HH'S ڛ ]Fc zqOU8.Fw$JcaR=Gjp`Xt(:gK/W=#I-q!u(y ``'5Ocs䩬X8##_5*kGb73vQYRowʐɭ#)QwT$<YZ پu MqLF<\=j}?:lހq,o$Cs)zCF'45(XʌYI+jl mI&g)ÌgZo ( 1ӚUR(q)h(9#w i{s) =/?Z9֝P—׮(ۑPh|tGbz KA8Sam†aFϵ3;p(\f}ϭ8q?c֗0)p^8=h=ҏZw8搎“}ycA@ ==(G<*nJ<`R`ӻP0rG& 8'4~\t(3p_Ê0Q@ Ghg@ƕ'GJMS.2xB)RUNHh/Qv*\Swfd}xv^3enpL! c0i=t]1}1LbN2zb\H:Sy} !1 9ʖ`HDag4b? F TČmD1肩= P޼@%$1]flVkj<ٰҞZ'{m|UO[4h;}Sݨ>]79,@W1L8'=JJ."gj'!^GPC( *{2AAjWD`5II;qjd@*ܜ :|;w$s՚vDRG|x-t5)lg< zOɬO-˖[L)o>CbuPMc})q=-sXlsێE.Rp=xB R E3)8H^zzP1/SL0qi_Δ/8IR PB{Rb0#'4?@瞘p3Rq=(x?.:=)  8ǥ9N?9jL`u)C#ځ8OZҀhϡ,0:sPGҗ4zSQgK})_J?(3Ӛ8qMܻڛҗ#'(۴*@7 ~tTAxXu')RQ,;dcڀx;R1(q=3Ҍ^@ u)ԓjL&;3)v@֗+ןʓy'!' i9#y I8&G!'(A㯭ǵ8zgq8sM$Ԟg4;tCw{Th}P2sx y*P $jL+K0q@OHԳҶt{=IZλ9Snrk.]^Mj-?Jo^uXn$:9&7g4gSOcFObxHF[JRd`<8I84x})Ĩ9)`!ef\YEs hHۨaWM!G<`tn+8tX%ޙ40wt$[/^*O\tR{co5 IMLp5&}NPq\QڻE-ڴuDX늮-|Hc9)Mi)8"2ԦSWܯ#K<ͱo9lA w>%{2R1}kpzeCcmOVN1I9CeNN2rBR)KsL'rjFF pq endstream endobj 32 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?0>QҦPq `SaRցUT>Q xQP!mVHq@ Ǫʝ:ʊ)Bb@ұ5]4-)N#R;lk7[ƳJR4,ҼVdկ<>H=uas:T[ #9L6Wtklz\R?9O""F:~5'A.t".(QPz/ucUcgZ[Ksƙ'g,/K 41ŋ9\3Sx~Fy4-KQsLt=ϭr-.^\ZO2Fw)jwHt)7nmm{Z`VX ?+B?ڧ;H1g99h \UP\ݢ߷x:㨮"y[ ~F?ҹKL"(ktr䍽YBNRQf{4~U}pVo;fԞ]}~[ϩNTzʣR ۠Ԕg~TQ@=I?*Z1@ h.(?*CAS :ʙ$|B ԞGđX@cWly/} Z*䢷cVUTXr\z;U+aulu2 ٬ӚYWͪ?As60C rJ$2p`ƺep4K/ps5V[oY1xwx5T]KKq$f/B^9 be5J@`[}JekhD[án`GJOe#FI2q[TH,2>WlZj )t$+7gwic qJz3}*ΗPE"d?vu!NNIa)5ev 4gie888=\}>s# 36U`Pγ~X.w䎇r8xhT;ܹ#֔ԙ Lʓ~TP`zʎ=KI@?*8~TqҐ~TQL&zʖN=F<ʗAPih0=I?*w!۠ǰz4h01~Tg?*L{ʝ'zCAR`cv t4;ʤ"*1~T£=S1Qց8QOaǵ qڥ@@M9=;ԊNz +b Q1ڞ1f'I`@ ;Twz#擵8Uo#'nXPIdp8DCM\G捪@B7{>jwΌ};r5+He ~֖CQՎ`<O 2;x6?hU215ϬjLQwlmN7=skFr<(Z72>\L|M؋ex&ZIl&2bL_8#`O;;=SI2ںE7oҖT9yRq(Ok;kF̒wG+(lDiQcC{<‚':):iT*9ƓgC<xĨpKLJ峛C@47Tm*Oe6oƷ]Y<"F ]]*Rr_ 0˹lC{}+E5N126`WsA%g-,OS׬{T!&:3M4MhrC@ Gz(Rbj)h JiN=*)j@Mu.([ˋ5#"%2G* 0<)jοE&XDa'iVt9p.P$Xmnj=M(Քg~ǧCMSS/ʆb_ta=<|WGpH?1*1?U#,GLR^%cHR>Nzg^";vjʵ+A^n(KbhrJ36gWOҴu;eIJ\=:gȏ#n#q(KBkiL]rB™ s޷u ŕ*mw~5i&6׍hgKV{af=8ʕQ7}L)=傰À19'fY\BU(QOQLF;T8EペԒuc ԁ}R1`)9)$.;Y=yCjAbP݌|ɈY(yjٙ>j:M1_ܶ矔:t5׺욤3IpB6sw0E 6;q\׋O4\UxuX]d : W$ۉw*#pF&an{8lt'KIX}vۣ L%j81uǸ<>[e }?}pD,{e!2Y޴RMy:)bwr]-a&#Ʌlg3#=tg+.(R,,9'i zg皿_ƕGwyɉmw%⒊+S(b;Q@j(%/z)zKIQE袏A@ {ќRqMNI:R?ThwތQ֎>Q֏jCM!;NɐH`=== rT= <ӋʰXgbzci5l7Nq*at9NscTVl(89KNǩu~x+Ho >ڟfҬQ4Ӎ0@袊) vڒ w ^Q^b&RcdzuxqiT"6è=<}kx`[nĜ`x{k[m-!Q%l3zW^J3ױek{ts6G%`ڶvXd9=z=[Qh'-ê_+= (˫fE.JYZsFvV[<nsVAVk-mc'yuҫ-R]6S mDk$z ގQӵdV礃5{² l$RP8r@9ֲAo<B[:י[8yUKns T9&}>.Vُ ^ơUf2HU0aXuow{ #m%HB6)dֽIRf˫=L8Nt !;-!]9ܵ²l {qY]I#p)ȯe03]Z)]˩8XB2c44.X*pŔ|g]qk#K<҉HfP9=+f6+9'lWq>ؾҟdr ғޗR襢%JZ`QF((.(E/^6Z1ҁ)OB}qI` GjZ:Pޒ}iRt94v'֗Gzo>ݩGZh9>٢S#{Ǹ$z~@;x77L!ڀ#eWBpz^Eq~=eF-)IG M{VJ5U:=~Js_5TwZV6tϬFZ$(#8j\C-g{4f1i:RxG[Nky%9< kSTW[ȯMĎzg8]Sߖ-FI FOx޺]ZM,ެ\,Wҡqϼ ҸPʀH 0Emy^k|z'9ju{a"=*Tx W%k<60&6`MӓS̸rk4 cV7Vd-؂M@/HS%;d@̌9u\3 x+o&W/o OoW<[jo~fc;F~FŚ)?\#}Հ9@WHNiXR(PFU*R5f8e/@ak[TWI*yNZFXEz&lV_@.g[I2pV]9㊸I]sj!6i4E.(;Rɣ C򯹠 E泘Cۍn{ f[&)b=Z%Y 2J76. peG\~TRpp:>xc:9ʢ \ts@Y¬_K*X1w##ڸdMݽlUMٶJ i ]ӽGFǺ+w;E9sPwfK)4x'>un5JW 5;x$d;gYU$+W==G\0I 20}ʻsiN%tOSRvHvFmt:@bs][DI XOjۼ9iNJP\jT.ҤK2wgrp[QIm Ĭ"7Kj$zo:ܝkN-_leH?vEYs8E6 (yy pqޭ9tn}kU88ۓrܶӥH:R$s@ :⒐—ޛ\PQMJ=h斊%J> m/z^sGHzS=xvKHFh;~uN>1E&?:w&;4t^PCB(G Us*#r%a[4UC޳F+4:3>9j\knrK9=cK;T;O_!66=е+"6ьR וKAݼV^GJ_ 2]8»n/$LxyQKFT1xquՠyl%%\Dd2A^YA- Qeu*>W#uk Y!m9J} \fGR4''DҪIҗٛ.J;-n4fNU~?<~uy姑v HK{-Qm5S9JO}|T~GJR<|[i$9\y_+iƚhZJ&QiEs,ap2JI778Q>w+S礠3~]M&u)#[ۧSlۿ~XwbU^{i&'DGmdL멏(*p%cSNy/{x唖Hz>_ΥNrV9'IІ_~xKլ6ܑ+xU))- (Vpvg$0sPO,\4KDky`Z9F"Y]hzR#KSD kNVg]jB7d[S`1'vyޒ6YYE.UN}sk w暲0*Ѓ]6m{ފ@1`)?Pz]ik"ңlᓌcޢ ҼX=[V"pžMsk]jvJ49TQ{M1lwmO rs1{6:A֦ѭ%d|6H1nf/hui,.wPt$k$UT1.vt#Vκ-ڀJ23+*Q.*5445/w5%frC@b@z;K1(斎PGZ Z=Gz`)9 Rf?h`@ Z:K=h4}h8'j7ZLg7?~mA `]=PxM=~sl@i"cS(rq5vq4)`sR4"<_czͲwny:~y]tc W-nnk~gH` 'oJB(EVX6gin 4JNszҊL\m2+敷4poӵu4A2D9q8V-{/+ѷc*`+-ck[ix&_8#v#VO}_}xC<^ldԏ\ؐqյ% yΌ>b㶡RƹceneEZi9c; FJ|r+!y=+VZMx^%Z i2 X8.}29Hu y TvX)ݦsBkӼ8\zĸ yp4F ?+`mAWSS/KzLym AM+*svOqE#r1[NGOtZ~6>!6% fHIPyf#aElDBcYƌ}v;\]ܟ~39+nO lJiex'R,JߖGNC~&BS: Z_:OqnĆ $,vA6 ZX0@FISWm#nqw^ͮbg*B^ 8|c ԏS\ި02Kݚkm'S͍ k_\b,v>N~=f. @m9ǹ]!4ukDO>9\u4pu(}/ve5WHC<}B֬FUW`[H.h٢Z@:0u4@4QMKwQ@zRbJB8~٥9@ ;}h;NiItQ!14JNF}h"}3={iӎPzh xvҘ>簠[J#; 5_f@ #/np(#M)N3N#bkktd`oC?u|:p e g-Miũ#˝}jUYx^>o ִ[|P@\W4=:ֲ=%&_(7qcVXK H%Vanl{'3<ȢW+3tv.ֆLh6CkB`־erHdcUw8#0tU="8;ݣv;X`39mAu'ےMVnE3V$+OvV.]LVjp[|đջWnb:LRִr%clE_iR\A4p^e?-*?U('ֵ3kWwCwGRةLvRnTRkR mNCjpj j\LS)s4i>lULa}?Ds+f -?hhs}zlĐw@N?>;)|}و͟רx|wd??ys}0C!6*{M̧v& :WҽRHpP9ަwRIri=R)(6*;ZKԴMNG8`Ue-&,Xө7"N*cKqTBy`÷oJ,#ېXnf}Oҹ6,T%A]K}w)EeC{zVK=#a{{Nɰ?HOz`I&9L}[%Fc, 9aX6q s wJaUKiF'Uni IxTUx& 1ֺSS·'.Q1A,wN~_ֵJA:gieyp1YBtL'2j~?&O?jE-OXGk9T4Tq'?n5"ZN&WH=`F`Fua L4D.;_[M[D?KϿ>ơ{0G.jQǿ·?; O7a?خ߉<wS wmo O-iBӿ>EcVeZdU;#]P]tƼb,oŻj9*QD()5d:bu(tڀzNh^Թ;P{Ɛ'j_oJJ;z})M'ҏ0٦jwQ4BvzuJ9$*zP)=qA6,s(4QKH)hEH:q,ҢBY?ҼTz|;$+9kdDo E&y}^svq;㦔ॹtwSۭXXQ*Lҟ +ƓM&i i44@ԭLe'VJHS*fBȴZEc&h(4SZe:p `)š)1y[޹h:#OҼֻ0Nju4zӅw'4vt? Q(h{Ss֐qGҁG/|}=h?NԜKonԝJx(sۊ;;7ǽ{Q@r}04.{c5hca?ƞ>7hcazY:u;*zrH+˿xcaZG/:Y:5{!1N*#PhPj}^ajQ^O HģCGsօ8W{hw)@?VNZ?ƛM_T=6Rs"JʚC RV=_ybt'3e1p8+Q5ӆ~dcVIŠxԢGfR:RAF9h=}h;֏GCJ/4f1L(nGz)j^ԝGj1wz]=Qk^f⤸}9[9^Nqt?Muݦ/oMzǕ^:0SgV&?GO›{<Fk CҚbP_Si45k݌^ԞU˜PSz,?7 ?M]+Hb5 ?uq1+²5Xт6y8_C4CWg1ҝ("nI3;FxJdyavT>y'KO^s^S^=OSՏ)O*A(:ҊZ(AZ(=~tzPA6?F)JSӊ;~4NAAh4vri9(; Rw0I"o,wG$ӈ RXNbaoO'HxM13\AM1bi6 { Y" 4H [yҜ'J͖^N1}~Gh:SͼC[RTe= WW*wя`}vmVPۏrk/!x/SG+^Pz>{V;µ)̢2)M0X_}5X_> O{T\z 1?Gr[mykTo[ oSK~ԝQ4)K@ )J?h;R7HtwGbJb֌㧥'zN٠u?ZnyNRv>QaJE'~ڬ/z9)H k;/$W;տ%8%hdYifOn;yc4XF ce9=iݑB9άZQ1ޗY8zӱM@GQAAf8Naɮz'ۡN`x()+ngk;1ՁQۊ{Tu^PѪΡFKqԝ _;q }y?j񥸼cCIcPqК[[M]s>_'}Kzޟk+~&<t}o_AZCGWc1QBx7 n ƾZYB?6=+s#=kMԭ,c`@Edׄd3kڬ5+[Y"] a6>>֔{4t+U*zP8&ǂC׏[2'q^FڷX&_LƨHPPL4M4\c#-]!gǂ4EcD(|4OϭW\LA~GSebUgA0\\mjڒ^5vp2;O_+oW}&bbgpG/s('WL22?*0ݜMKZ#λ,H#<K9ǩ٫ta)&jQi!ʑF5躜5:F0,Y8 #\{I#g&S:~R,r}=yOÍ O?)Lxݖ6H3y?Z>=n[A&J|YޖwJ}\ָ_*?λ̎?μ9~8S? ;RuJ(ԝI -E'Q@AGJ^=Gz`s4uڀvڏL@:}iQړހSz)'S@OQHzqQL ʛЏȪ$^cN)p2i{ha/P:ݻdѝ2kKӥsM0 FE!jxJ:C'\P՟rz7SS4槌y"9dǩe٥4l;InҭqYkhrMZLl;JnGze}n_z\CHazRn4gCzQj\E `7{Qϭ(SCጝM"?W!8U5`Jy/+k|'+9A)Spt_Y+Kد ޚc[L4L5#iikqzܹMu?'!jR4{ ØXF2n|nm <<6}^6G?)1q f{XI0^pYcANx曧i8cI {.\&`@?(=XLKս+BSw~"SR}Y6z}H~fO!+EF.qqu]"紘n< rXTK2|6]y7)?j%-|2; =FK|paҹo s)ڻc^tH3חf0ݸ q EgO-Sgk($QaW|=s,}n`] 2I9BWxxt8͵жNz *9O_ֹ{jH1>XZиXo*D1X2VR]_`i0<95ɬficuEÒ;Iٞ`lp2Hth͹D[?"!M_cSEH㌱9*^?}?ʽWdjF?ِ5")5f+1YoHW^tW?~HLZy@&9;Qސi(4SI(9#'aG bQHijNH:(Gn;Qi{SsAQۚ''@qL=? )9(oAG49)OP ZNԴJQIJh{Rw4IހŽ/%(I)W5UI!s/*P;n3YL1Zqe99ɬ)=_,鯛;1i[[u?o{d{܏z2= \8{ )0)xdPι,fބceZoJc֯G Q5#L2@"»NsVh]#+ ν؅Y kOp?tA?21׳xu cVǦyhiR1ih͋ /34xm鄧AG|+o{j GE>fx_9Z,u 6V^{</gtC>皖]ߓɷ|w=OCӚ58)xA$I]VbOZ>)$20@?g[YvHo/'>m>X`i]+`q8U>I.Ip^,j:ݱ`0O_Z!kF?ai{W>_ B<a(P::u})}!s 6wP"C 73Qc|MqQӠW?~Jũ) n8 q`1F:S>bC? KMaok@2QaX珥aM'2բxAnx vastSa!-,g#dS@=i{O9)(.}(⒘ Q; ##?֐`hIENO%;A⬑1ɥ ;tRgց)(P3cH~'+!?һ"57wPu&qzn9Jc t=?g].ϢkcqZ^}XiI@) .}(=) N%ҥn;( `>+ 'Uf.?ַVHeXm#ףCG4 j)~v_Z) ~UWr8H}(zZG'k*dR.i4Y4M< k~ZJ5}-Bn?B#>|<;5W-c?3]E{1T!5t~YO==\4M;:]@Z<,Axħ71:e+KZ^pB/U?՚m-dX^}KvЫ_x7ƣXKo5~k5ԧ|! : _ &N.*4RTW0Yf"ug8zoy|?D.^W^K%ϟ ?(8r>lӭ*䯼Kj_ +6$PU^:lҴI- dL!#3&bGR N`G6mޭȦ&qnH$ֈuIֽ3OQY  AmU:f#isֳZz3 F}Qۉc#8(N薬&{S6 0.JIn[0:>gg;Snjtv*H Bk}3"|MD4l4mv"&ӳs4cҺ~t+>+b?Ɛxg(CgI1qw͛ۏ]ИWW5.'eC8j*I4kF.. Ȭ eHk oV{4&'oBݶAk^шhXN ҢSGd)+ 6})r !#f(QwMy8tHͽI uaqLKQ-#͢O(ܸw[`*"nj&\zT%jhqqi3/BxqK!c W6X_d.,N윊+Z}̇} =-E|UqcK" ii(CMRRҼY=,BA"Yތ=,Oj#+3|6 BW?qcU^e )A, 6i3A"hBk4GЍ{+>-zZj+ acLo7֛!kǗa|()R6آ]֞KY~ͥt:v8w[ֵ3PxEf!$(+V3/+D֫J߇%:VƇfj);F~Ybqx?5NEfU=)A]Ӵ۾c_>V2Fx()l*{VQo:\+m#nI籩6Rw2jºwTy~SwF&3G? 0u *FAţb%Xz?wl)QcWӟv~7tt783d9=i) 0QZ;QoSS?ʀ9QHz. ^7Rm!vv$p9!sA6{5{MBK8G$\B^>V9Qs)5 ͹nG4%Xujf@o"먾=i/R\4rWkiz~M?sЈHIk&640: 0Q#d'*Uq6Nc:ȑ-ʴt>;]׉#IwO,W?Ru-Ɠg65}^uʟTy&{]>Q le@JUM^uUŰ}\Fz=["^6n%ǛNK$BXȨ͕HE ;jDZ ny#?\Tc?*,!#&8NRV)լޖAȇV}\T*e1en:E)!,68Ԭ:~PɫWsN"A5AK(] u+5u?u!?vCc֑ZnjV(qh"j/Ǔ٫@{R֥FKd(r0pԣOzWȅƕgd0j[.,Z!u}SG-#tKv*jc^t2t;[-A(0Ep c'i{ע{rC$zk^Zssby40, }-j6[HP㢾}]"k1FM}}G]29PIRPRc)1NP88҇k҈3 xOgBj%{FhEm汼)Q"ia4LcA Ri3L&̣̪+~~֫{̓ ? /٣w)a'D~k@㢧gWVj3w=Pr)>/\5=T<'Ȫ .Ӂ^ 񝁴YPmYmGZtjEզnsEQ^PzǽuĢz=۰ynA1Vfd=qޣrDܕ9Rʭ;{{V.:ia Ӿ^Ƙ1HT^`[RxwN?)j5i\]qkxkQ6:XGS:l.QV),Vd.7V.ژO zB2ֺ&4&%rrsސRuޔPz@)>=hhQHz1Eu6I\S| xWV&_cr9 W (@jϔYF S)wOHNK寡b!om1M)TZ_SG?hF"Gmn>\}A֔HW-br)9"t3";]Y[ц*0k/vq~;gM>f_j9).9f@+Ym4̣TeϵM ytf/F}J6v]8;m)Yw3] dc5m~M}QO>tdo>i}#Qi ?微S:2H_$SZ-0uQ%H0]`h?ҎQO"M>IK0ASKxN13~mXi)c2z~^M*_scE++uʴmz/)=J^?]qG7Shyͬ3ZQgzME229WXW+qrct1\6FL8r?jZOV##sc֚k/FUAvSNM ijX}N$@4hFz)z0a&6ZKКauyGn\P⎖OK+?MZϤ-Kvż$^9~+q#o5F_Po*ZG-um>nFTw `foOa[*/;m?LkUؾ kMPIKL~$nxs>zw WN_o?܈W+cȀRVnr7-jvMJ6c$1&pI,qJ?W j.hByYaY!YҤT 煽[s[ٲ 8PRRJTG}ᮏ] VR9v nm#ef+ا>xyu!+ )xC)HtBru1xBɃWY1#Iy*wu^4,*IjAykSg+|F卆/- j/"1W s =PkIu>O]nVm|S'ȺM+6kdG"B*iEʊQOCHvi/Ӱ\vێXTUVUڥB)?tcM+ѤhA\iA??KS?tp GzvLz~oB3>Cb ?O4lާz+;y.hT\0pڢR})r9mn@w5wL~QD.bڡo"t4|H4CЏ-!C$!wʴЌwD[qF֍'iSU0rԹG^B`MIZOt~т*jEajA E(2?J} uƂ%J_%*#U~\D{y^V/SST"]R4BzT?dԪa\wNdb+I*E5hYҝ$jv?ZM`S&ty#)|sP!OR&C4jp3JY5T&E6,i=$̮3R|I~j"{~H$R9`:(25 O>2J{aҭe,cO0W ݕIi~UH-*O;Vva>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 34 0 R/Group<>/Tabs/S/StructParents 4>> endobj 34 0 obj <> stream x @Dn.-&Eb(Iҝjaf =,Ӷ7pUmSã&F`eG B!ΚkxW0)/XQfMZ4P <S)B^F+nt?.4w0ÿs/C endstream endobj 35 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?U*5GR@~TARJ ~T`zʖ0=K?*)EAS=@ נ}:Mq?*x?Z%L?*~N#?*U?*(T?Sq?*}!AQǠphsI?*\sK@?*8Rފ0=F9?*(Hc~Tq?*(aRzʁK@ ?*Ls~TP`zʌARP0=IǠi ATB ަ'VUZF=ͨGf|@qDm2AsI̐O$Փb|ѷ${PRj*̛=Z{k{dy&e1cZEVqn^#KĖVX \ tiIҟeeCy<ǘ X"\wrIJ5>q7vk G;E=I|֝}3HY.7<㊸A@[3e*URk4")_-*m9UDD]{S.5fg19e$9T)= %()}9Ȳ.@ca7 9E5`C Bi*XDq?*Jj#֬~UcO n_pszZqL{M*_ʞԁz? p=IN\%S1~U!9Mp>\ԁTs=zPU-itM- OV^1ԍ4jIJ#=d쎌5%:{I'}K]ֵt_2>f V@YNAӼAoeYXK̹hg\wz6Z]RbB3Ugx:y}j8o:g&JkIf5 TԎ"vRm#z/,׷E1U;IB95+p#yJ֟*XA:jx({"L+ ~5O]䢴} I+>9O3#3i%pMf^i1t%TzXL|SJJ1I[!:ošho0oԻx6hO4b Yr4iY~N+zy?UR ]^XhrT`m<h?PCv5c:OѭSE1緼(`#enb"~gv ZhvC#ۼ+\ˇA ײ&ʻO&խsQ3`{抱}RNmؽfhi^4-Co)j*1Љ͹:R3U-fFesgGZ<垁[ gF1T\=p?Tw0{Xi9RwMHT:֌sڤAZn!<Ҧ#SH?:*@tʉ}qUrۘaz_ ^83p?'rAcS]K J#F3p:Z_fԭbryیz˒Y$#6zImcңKo32,%I1ltci;3M-mZoF4%r _5յ̺rB&3F E\נQ^\:@V\cG4xQC]v:\dy([Cw⺨I۱5MzK%fIFFHɮnC*:VōΑI{ivۭ~lRHH_5ۀztK3# 1$H8>r򾦊 'gcX۵L(OyHXb=1WPSF9x$ ԲA}:()hQ@h =Y+JC+58 SΝ֠b(g4 ^;Q@J;h4 (ޒ;R⒖RdNRh>!xOp4i |tf? 7E=Գ;y1L28Mj)u o bt)Lj̅; XF 1I4Σ(:'OuKsD]yWxVAi%r@2lǭaԌj!'fSYsrVKQFxlF//`:Zz31.T_yqȪ1Iji\GtY'PYzjvN %>&,Vo6I'*4_.f7Z',qWv\E1x{P(?(וsͯ|Dk+#WӣiԱg*=f<lku&9 ;ON-CIӥ &C[ >PImIj˞*JѣcHk"agy+A\`:!4~8 =ƣ*͆mr,t[KXL|~5K\Ӧ `c>%4HO@V}5)OFVl&U23- GZnPXQm&'sN+á!WlprqCL$,+ظ㡦֤;jL}+RA|ԫ'1\/RNy5x_^6ju$ݕtSkeSϽF5jUɂ7&Эn~qey6֓xb,-䉚S)>TfH~%Mlm9px xҼ 1G wRz{s\1MT8TQJ*M݀ɮKךFK3,k˰_ǽc[E{z&>B(R:cG6DˑM.]OY[kdv.1Z֞ڏܭ^dm&"FWf@P}:Y;1Xn+n;ŦY'"ϑ\jWI`*{VmKs2(Pl@dg2{WO4"jG{=қʦOU܊rqfn R'8Vt:RLCj֚t9%Tc+oqe-GlfjηN6涿ncq"ɐF̷(='B#ypUEuuRn 35[H"#)hT"RΝUNV37%|G&P,[k.SB=Of[;Rbm$(r*pcۭ#.)q})h>WI%-QE-NuG7_N+R_O5>24@cT RJ=QGcGzC(4v@ Gz=RtF(sE8z0ӧZU8vO-O[bg W.vȥvڹ3[!&>jѣmEfYBepk~8p݊Wu-YI&Qf33^yIu9:>TgVT; GJ_[Imi4$JIc\{귨d`7;_j`ڦX3kVJ:صY!Dw+BƸq[̅$9J5̬6< t$X)Rz85p sI˫6Hel*@֚zZ x6hS@ &Fsu}rkؒN0"R~&qW\\ޗ")Dl1ʲнoًql^1PX^/ٿwԋi/wˮ~gP.<g#`x =k;=ΩǙZƞ, T";|~uɩǭvvװ6G o!2+c"z)ɭf`T%v_дêjn8 n-g:M$\cwcLf4CW*kz~b `*ɫݙVOmf~J<~|TSZq-r} uZ51iCfnJ|cfWKx3/L涋j)lkc\%j+"i0$Nu,(^֦ض,VT@yjm"ÞD_Z,3u#fjpZIj1lxBzp:֮ՙ2N/SF=&KU!!1},tRtj#8Z.47{)meӟ>YUտ䑀)vLIsB+ʌ>Rx:qDDN:׮I g%&fiy'+ Th5)"lj`eI?2Z[jcȯ %O&Zm6gD&22䓎ձ{_=xq+0zD̬Rݽ.gao '( *ӊ*Uc'bq}))GAB)h)h)N?շҲ֫VRt(4G_OZ\`Ը恋IK>ԝIڗxQF(IJR FzWEw<[J'@(rx) ?nۘ\f6im{Tr[ f¡eJjnt8ʚռ<[UxCXNG9<j]!=ܲSS{s/#Ȉ}j'QtGxvC3dڵJtqHBVF-܂Ligp@Rf>EE٦QX"2F:qֱlǺh0TZܚgf?|?5Hi.Aұ;jFpz \arp\O>c@b Pg%|+`v5oWchPӭcM6G9jL-Q$Rz{`Z˶Aq4o$IYpq/}HV6MYZyȡ#ӭ!Ծuwvm y6;=nwkR[+jU/'{;d{|,r\EXXH啊W<;=ռw+K{(1D">-EĴv}jr+jHӚX9r8}.A7jWiO-nd&I<zVFz #Vqǹ>d-Xev¶0:qZ!EV)sBHzIYPb$,>bN1M>9E(`oMQ6De$#E,/ψ؝Ah$vJ(>QK@ EQ\ޭKo< B סZZ&u;Wv)ԂoxW\E bY@sր:YIZ>SY)ҦCD֟ꦊo֠aҎP;Phc֖{}Pc@ J?Ό~wQҏ t,pFKҒYc&V 1=ykJZޮrdV:-S%CE82qO=M399.O5ApzS޺c[os8YFӸJ:\@m-$-\dJdvZzw:zI8]q^[ +_XChV 9Ouu bXQrZ$uҤoj2"z/5iw4s [Oh)<`nK;̷]3U  qVjNui>g7*)%(\@7sKF9e*vWl剑O 9TIiFiɽr!21ڍ'Z@65 a%`\8ĥy =Z{ۏc҅)r^GySS2j: ȧ<Z%.IV-ŲIY e\:%OF9=ϰ\ݑ)F ek9a;OmPBGI8&߱+T-1IsZϴ.2׏Zջ:JC,[{̄AxĄo>5+htƭ62ίOdfdaʶ';s*[V9_}h& )~"Ҕ!O؟5"??Ұ+Gx3m >EF@4m kq8DQc|ienQ̠pmLzSY&ͩ†Qǩo.ǐ-{McM~$K&;XfS-q\&K,Ka@ zLh-o-|DC+B嶑ӟJkb/)2ꚜjPZ22 06[Ń;ַ 3Ln`mQ9cAAzqVOA-th)*yl:=xǵaֲizD]#;{U~6\So]=:hQ\dvFq]MRny 3nDjhiTgMVU| m&IHAbjcD>N22*3$oͰ-ݹe.h 6k_(2\!?[WyާJ(>V0S--W!Zy|y%m[yj:D`/>ZEL .DW6=uĹ }t2=.ɍcNl#죆5k?ڐ10O0#FJvbf4t硬Ok:ƔNZ}@4v◿4P}ݳIށAIGQI@ GIKހRAl͖y5O[ǟq9nMZ&3G7*ISfVHpIHl*`A P7dkONYtqЃURnRִ iu<@Y;eQ>։W7?oQ^{׮٫j7j21RcTsde+=z5:瓒juQC+*\5 NFc]},ĒlΪRyv2 0͑=HKy\OnJjY#Ģ;^8^Z:yq,zֈi۽{UɟS]#4յ am%#~y ?ZT0A5YcG4K`{n|1^ 5V$C Si@4`P?PK!ٗ5,qܳ(u9zWצ">X孤1G溚FNܧDzVնn=+҆4rO~z!\Nǥ'Zr秥hAxbEO?\lwG>M/;ÐBLz`XRm@>V|d{-(6>GCK$^M#k9b&o^Xh%FC\vAc4]}S{7khXcrz3jf/\BeX`m:KQ,QXE=*e4*$URpw)1\s\Lcr (8R"o4c'ڰ/f٘ [amv͊cE\ V<,  8UFշܼqiLYe2 NjU$bcbeD ڠk{YF&* ${ {¡@tmŝŌeXfy[%WùT3bm]i<[!d9s7vW:rjb)@ vֹrm&c`Wo|w\0붖#Ήm7*?vcua4fMD~k7ڹi(.V$ E`[iʽ|/FCW~X?s:sia2G#vڪ~fUu6ʳfz@M*Υhmn oǕ~Vƒe\9SH7d/|RmHy'~Blm;x5ϭGn[}vJZQK@+۵x,l#I%/)l;WL?%RBb`.1Ucms!Hc^2?SխKo=B=FlQE-PW9$ݛrH+O{XTGKY@r@&PᏱ?Δ f>c_P0ߵ.y  vzh=i;cSҎ c{RRޜ=hƱfހk Eu]B"'WU?rI }1Vڡ*sY%Rg'yGJl}(3I׊JO )x Pđ~^a#Ķ˞^W69 4YWqT&bZ : ;{9CIju9} l#B#T=koF'L׹*n#HRVeq5h)TB]sV3kcٸi|A D=*;+J QL'9깨ҦPfo7PUdZWSƻ2zݿB*eŔg3X=ӿo،~&ErU j8 գ$UM^L}>r ZwpBrYQhQ&{ c I&#Rp2q'@8zROBʣj](72C!@=HYHՒoOipR3AWkķ ,E/gh["aҙ9d.vq֝1MsE ! P]'[%Q\W2Pս#68?ɥ-=V6\u] FQ>r,*sҜr8!ڀJ=F*5`OzˏH>DcћS2|\Wm#Qf 5R{;@8񜝧Tw9homjHdT){^$n8x)w.~F94n(k,caIWu? %|\ npB96Rɴwqelxp^Cux"9r@;N +ݾ(_sCt)EyIkN4ꫜ#Tq*8RlXTQc7*ʨE4}4R #4KRzF6a#Q¨5XLI`DgP}ߙ<6ݿy1t Ž!>ē&Xݢ̏y|SB) '>'CO*Ȍ¹Orj:ZLIAA<~4]Az};uE01׮;{XeX,VD`aoTܡqJ(N!z^gP1O4f4PҔSqڗ@/Zo8R C#^t#Ǹ:$3~FuK2䑿!z(0{cVz'DR)S*FI>sj&h !$BQjVm&tNH@X`TżTr<Rbkx 75QGZxS%̬T]ΠW=MZ-)ПLzm]^-ǪԎ4;dfl7k˧x1p1$B3SJ73*һye5UcЅUrt߳9gf̽gGִR1pAוC#C P,y^L891#J |C3m95#7 KU# ieg95lGڼ0pMżD7(=z<1y9Wo ZPy,J ?S^ -T?.lU.VFVJ.쁁R")476u%ɶ{)XuIrõCiiYwbۻj x";>wN zsAyGQV\r[%&6uR-ٯR]Bc eͫDy(ď&{#ëI~qVzw K{aRF"P:nƽXDƼ3Ӓ,HïUjn?]MnsnҁI$ )TRC)M8}(~W;q o K# th`W%o&$ c_W4[J{keyxKKE hKEޗtbM!ܳ7]?<ՌRǵ@W0}: Ms~uc~4:4%oΨꑲHIfSyE69Ppf'm$,.26 uqьu)<I GQ{Q@'ZS@ƟZn)MJJwj(7'Gj\wZ1N֐ƕh@>ME(NvXМa{Һi|&SܨU27qҕUڧ>&FGVBy*c8?ά&늦c'aCjC4ݴm>|8doƲR7l?$e(ҭ>r9;OѪ߀.b1F9+F=<*NiEr[28qNIU]Mք"7I t9Dq/$~U;+CkN?Ǔ[pxcI힯U6aL{ClU*m= e]jSB9B&}je]2Hr7[}.N HS0D?i܋[%k96l;Oiy:p>aȰ@ۭ!4s:٩ql((sƱwc| $Sטfijw,޹Q5E5N,\R;篵+~uQjtpc#/_7'v1SA{P"]ùUuY ȐF0dWCY6xnR[EoEh$`9(1#@0FKm#*9ˏd!~暵֯gݐp?zEĬGf\q^^2Pr\hz8(n.\wi k=T!\toR/Ak ֿ-}4]g4WkcbEGx?ۤ1RAT-Y62r0=^MkVpp"(*oIHՏOɌskF2{=3"v 7Nҭ(*]xf7۶K,pl0*F4)Ǔ4c`g4)}?gC$ל2kGCW5?*:|B7nDq@_hF#4^Vլ7dsQk.8⒗Hj0?:cQʀy7<9뗶tXc .G A++9Ԍ):C@s-Bv, {F9iZb~gs_r!iL:#p_qX.nmآ"2V=\¹í]RR]X c? 6gxSMCSyBHxkkn:(+%)cmS^nR,E(OK%8oeeB¤엨(!$} &SB*A^x C:_X/(#g=ֽ9|-ĶK"oQ#^ǚ§iɦB掣4ސxސgMVޝy?t=~,E9[uX2SX6kdg'e:NQ&*"TH$`?ƚ$͓hkzF5WoN:Ҡ|s@XN[$x؃|'u^iBR)I޺[F `9sM+XY66Ңa)N)A :v0GVIF0W {\RtEv0tHawL6#+zQJQ@aS8GJv3{pr:c|SQ"a y'5Fz*I>e {vd\kҤ)+\-spO]>E!3 #?jFq% _S@-M=6w*tZWF.H_(Z:*Gmȫ-P>v  * YS=֩~Gc·rU&|xV&u·z="5 75&Jٞ|$bIy8v*1_j@1Wd6g-N/ /Y'hm5mWs-N<5nS֝c4W^W(>hw:tW7`X2?ƙF^^HcicE+=+3l{ fU1^zۡkYҭ#݀@qmJʶ?HLK )g9?ҤccMNAsJOjO].y=3X>0Om'3juxN"!ڣ' zHF1 $z̤"8@?dVeޯr KrKr0 T򙶖{$)f*,1(*nU8cq5i*ߍWuw S{H̸\$zU}`3W-E~GULdm怱x>oDj^7*d']ktXc57i/y-p$Qڒ4psڐR 7 '(>0].;fbxx\⟭_SW۷ϔ_A~@[.qP?~t6VY)P$n8 rsq9c#,҆4Dp1'3@hb#ڡ.zT0 yib=Ez4tɀ30'kѷOº*C籞+7 ($(̧T,M)u j³/*#ީ%_ *Υj͗_Z$sSTHNQnd);SQKd'&f[.{J%x5OW㊙nFJN _O"HGQ֎ҧDT2y VaIt r=jOV[:}o?wo=!Nfx/govEď%|,5wjvcx<+d\(W*4[LR▊.@>V)EfGDẄ́Gn+wonV]c#o?f5sΣ{`_*#m2U=5 VM4_cM${gҔOZ5STPt8VgNM jǥr9$q i=(a)p})í )jʲ[(gP&}n}3z-"OҸs'T~bvPk:p Ihԛ|r 9a?Yio3EZ[8 /jW}8t!ըmQUNPYv#KUػ~B@h`p?Z۹G&wi︁1ER*.f_.s'PdegÌeA;VϋT 2Ls!ұmt{~䵩 {%^y%g >W ryJ 8M#sg"eXIr9RO9ěCHn Fι$'U` (<ݶO(aB搞~+_aNjm!i)iT7&d0@*RkL =FAܑ^k6 Ҷ3-k#g5Ho"$pj֝qs[E#jzSsx1n~#g͌ճ{~u. tCFE wjDƑ(zf]Zg| WV57.#|;6ʒW;|8Mj^W؈94Drn:YIԓKJsaLL#>!y$HAI#[)Wu3/ұhQL(4SOJ6Nѽ&C px &pZ9ץ`x) &UGc]5Ɵ rmE^88[>ufp2[ޱixq}+=xRJ].i6[|?1EUS𖀟GCykgxtn6|W? h}+ֻ$Z)!4Pm#=AN:Fy׆ O77qG?D8?ʸڴLO lۏX's˜yȥ< oJNh Ukq#V;N?*sGq;s]Pz|iHǯu>1IڊBr) Q֔t^ky<}q]<~ aq Ltci 2+|cf~j\ךεL##Hh"\v}?簮+Fɧ/]V Vᶶ^mRScո,Qqc$Jdd俙_"KD. bks''=:{y'[OmpRexRO6[n.kRK+}Eei3.7>WtaC1;.@N'[p *3ϥajwzK2݂zZ0(lݒ:Ӆ|c$I;GDMh/"8 mFm)!kWìǚҞc !`]( \Uz'|}H3gw,9 "QERRvi@89|y+C{;m(AQ1C/2Xwb+?Z|d61dFZ叵]dG ]8З/WB;??_b-z c̞A 4Z[mA\3aBWdgb6!! +X4#iie,X}T'(/ChV93E6GkoY&q0?0M<Y~1Ŀהz}=iL ^ؤ4Gjoz~)unmK$Cx^hr }WP3@?4uiE!ޝfy;4wnPEoMjv+w-4B?(ӨѮS8#ҥEWk- Ęڊ'yD\^w;~apWm& ښ/1\,rCUcj*[\XzDkޔ[ϸ#̝fՌMf,xoa*qצx>H_,=1^_ v~-ΫOBjKXju)#Jǔ?Yw!)D^ Ax"/tZmڭdP@c8t>ԥiS7לSM8z 4s@ZiSOJmJ%r^) G" Au_ſ,oa|B1vpOB:;/tLB+!j^xC=;Py\}[n~E1r0*n7SA߅L֢zsǓt~y?ʺP8t4 |e_ q=3^RzC[J( ZJZ`%5SHx>m&^׻6`}mELƋ${XU9b\qzyI:dPT{XE 3ǥImn?Z`U>-E4cu|x8ЗS-qzȿWaLΗƎ#B}x:W'̶i r^@϶+JGXgl^Nk[Xo,T1 ϯi~uw~ȼ*i[L~WSJQ<g9~K;>(~U?o6^rӌ]pw?T/B3mیm_B47o匴>@j9y4Q@Tƚ)dW\+%C\IfL٧ggzpgliI5*2IM'㹑xʥOtQjl&[aY^9fZؕ'%GvD (nR){yE3^DOZθNfUPqʹMDYC @[Q#E,/c843\o"j&{+bU{B$P*0瑐;lF'` 629Y ÜfF?Zcj%1W[{cґHٮgcu8wЋkHk)!N4k14Q@4Ӎ'64֚z0s81Ƀ"!Y>%YHp{Z9us3:0++ ,@^#dqYSl5`niVÜݪ15b?1q@̙9cVj/Yo?BϏG+D_&?+aZo+ae/+:?8_ |0kҾFX33B_\_sz&P)+ޫ,h .j[;=?fyZ~.ft <tHR{6Oh閐Y&K7s^Z40qi)S$4nnF~Q7]`hRں O8ZC3:Ӷ67M$|ƶr+lǞE}[ ?*z ~_Sm5O{z/&$jZ}c ֿFЍl}+.B5)v+ -~s\zP7v:xώ \;?U4HO/?L]S t+Doipn]R*jf~9hZLe.Q 'Ku0rЌbѣ͑FS޵7d2jG,x=*ޒ=r O<~LR*CtbqACWrzR㚡^GEc)։\zRvc\JH_?k?k֯÷isLk{$ a$_{S=WklkWpz@?N+^Y5+6v`6QNmYH?[>DYSy⑝ڧ]:ṡ+h \ cudB(P4 .NkϮ{i #f05U+fc5U)##i;OҦ"GM[H't {(>b“P!;QI +ևq|2;'4% WTKI=H/ c [#5rd*Oq\w,ǂjR{VvH6&H=q]Iq?W4{D͝pGc\SxN|O D;6K4{D͝Jaaݔ}MqF9H4!oe}\TFn!q [7E.q3ѱ^Mؤ:\V Ko黵>v5M7kk2ݓgNxrq [+ȭ9NNQ^yqBzz3qCpF32I3-uPt$+J)95ӏ\iW+q#Ou,#8lNHQXx,EHs,zj8&@'5Gtj'}E ο׫ui+c:_zj(|h&)GO|J~m?JzD(IiMo6DrcqхܫgZ¬qOڲNT>]SSLָ,Ut7%P qkKlѴbnS=j46z޸L~H\ܱaדڤ%Ys!QͥÓlȼ~5WPޯ%Ӕg @2c?`ؤ۰7Ac+ 8_o+x o ")>n6¬S Tѱ )b>ofAi8F($xy# ,\a;Ox$+&m>#EQ}"͢09^mq-_ 9[PLmTL6ڢUSm_Pv 􃛙 կʟkڭOSdeΞuo#O "+tpz?HψJ? ]43+1-0O88.s|Pe 4W?Jg:%m#"njN2OV&MV*ʼh5eҮiyk=U@aZ:eXu?MGh{$eFh0mNz0v5c٩ʆ3MH4aM1T[ʜ!FOʿq  2!\(u@z‚jm/KbސAO[^ EghpOo} 8\?GY~$p #{gsZolE"5BKvZ^9^GrqWmϡNZ @1s\x.Uzvs@mS ʺzW&j #¶a\tRةso0i] /5.T}&.AG-"`v' 6ҳRBOCȬ۝Xdo7TpEuSտS 5QTq ZGI\hd=X'ez.RVgf;HC ҭ.p3sTIgIqJQ6le,p0M>n$fxFL͞+7shaM3Eƚ -P$6YNNŚGk%頡n: Q*IECmn^I"s5gMYdr0pG \M:yuHjWz{.6 />xgJڄkN}RILG\ȓv氼֗Iwm\"S^g>\CjY$gzYhv8r.rKw8#Μ}E#SSJb޶@i[2{:YK}:З6ո5j;i.#z+Kdb<6B;n aOZ-[xWkSQ2K Jr^D*åtE]a> )F6c[[O+J|ǩ©VUp#,~[sy?-ăX?DёN0I6?B`\䌟S;R+~F8S?=E!=Pxi۔*x#eGj2ړe#?Z-.tw3^r6Fs7ݍFY^wtFsݫ 0+"'f,@@][i@֙0ݒG򮫣 prL g9#ޠETBrƘ40붎&\HڭbHmKs55' 'F 镚BБa8:+ߔueJIC[D˕$~5-' !m#O3:m?އcㇿԎ-$4i0g~>(UqJC6#i#bFGCXD͹~SȮM"3d5-IԊ2h=̳bH=8QJn hFPU&{F/gk@<1W+I84KcQHO%3ҮE =<CnV$rpyYyAS{ Ymi[ܗBP+g'Ěoz MK^ӝV2Hap2i3Nƌj㡍iO, E|s%㈤Ur縔biCE|}?5b !d<1ɩWwEexF'\0d";W^wssXm:OIdQO$Voֽ; f1#VJ"䩫 g6uLZ'?3SE{PNisq+[Ѭl;uXXsҋmH}kvT#Kҥa{օh0QSֵ$@@ekbD~M9UNxNN-:WzLCPXY(\:d5YB `WQ"njI`PWK{R){qO E:ԑ6TMh@֑%oJnڕǨ'5G.Ma|/!7V%=lU '`6<{IuVFjk8.}Ă1VAڐ?@P÷jaY//G'8t]RW"0!#9̝WnV Y0@ gfGkV\Mb)\1er ՛28G UG%mnj5P/=Ehf6ΜHNTP7έ4"!$ڞ3[9O&ET?ڎ4xm!F~~5JIݤѰ'קʗG*0rm3MoV[:l+R̩5x9Q YɚE׭?=4F8`pO+6RTcDz Au"3d~Tu?RhIGf)S$eM,vP8??0Sshdqao7̓gV1B4ML/sA˩[8Zm2>PWۃTHkO[(idʧ仴oi* %&Ha[v$) 21T̤*HIF8M#6hoEw?ֲr~iYl(e$sjX}v86m}M}? t#!1dPt\_ó^Ws_<#`']~ Z7pȞfRE#-\?џˡvjSIw it;W#f: 6?Z)?}6+x'UԾ{ uF KOҊE/jW,4@ >ixOz7UۈgEЁBö\3g?J#Tu^[/"!$]9pV[X3ƤHfWIF?{+b4Mʝ+͌Bty01Ot>$y7VpD;1ؚV-+mcUad YG\h""@۽E [Eu Jc|὎+Kؽa T*qBIR8~#2Īw?hϭ\y^T2@9 a;Ryy8#_VT\JсsȮEElw2 +]㷋nO#杧uHۜ`tVfoE>k]$CJ2:SĄW)LO wCEI*39"GʜNUޔ4#YT8# M8>Tx|pE!9┪E*M`H3[$Q[*U?XWrÊ5@`ͤE}"99(Hu~B8ʱJ޶y-gJCnzӖhrWt6\0ÃX:LIcpk5ɴJgfʉF?t B>fo2kEv,aU>Y0G`D+?0`|mxL?x^ eDXO j!lntXၑ9ݚj\ Qh k ~cw•gz#qި2xĐ}.C7543]P9Aݣڭ+iR}΋՟=.g/_?%G'2+Rr7)W#Xm¸[b@hR(zO{1Uҝ6Oכ| vqޝfNۮH*lyH8^z(;+hšhQ)40(XnE3o5?zaR5$Î|T|#V=-V)~SҔJtt4!n]/ dM8EHWiTJ֫Tܴ:*;N;TNA1LU&3S{ԃk 9ŝ dn[;HX+ XL*537Lm> V7(#q{S.gz2+fT+Ǵw9UKhpch/Z& lQiGda*X82kwGVJqCx~پdWt4ܺtޜO +5VweFVbT\Ջk=A%Q4wQ?ZBҭ&04h2:p*e8CJM8"= SrlBT)Fۚa }\t&9$aRV -wά&\iq&u(GHvUȮ*zo PL+3Tf 2hiA̐.|{~UӴOOS[e0`iVcng;ywA&ca7qoƧf?l[Ex2?w9"+Y99nZ[+r 58Y;WpE@de=j nVH Zc뚰dU3/4LѬ5 à#P"I8zRp>SNʐ l¯[qC׿nF*QԨ{E 15:ߝW=x+/ZbdU 1z,eJ5d|?^xOԭYkq-v4Xj,ҷVaRnUs]*..Pvxs,{v:榲T(֨K ڮ{3ZgUIΧlR+7|'VJw?4{ >41?ޅɧYIb?UcPǾ} 4 :r=M0GPg1- SE_<{Ќ>$.6JW skjWܰҧTDdߟjC Jjq0`?TqQ?0CR1? aJ8S*7aLVCabsȦHϽ*8#NH{"8${I82*&^Ɯ_ʔ}jYH냊TR*㙸~n(V#M.?0ӣyQxƸ⟅?-3z硩rcJ+V$##+L)GPMN9T! r0ocJBRښd2U=+¢G q0aW!R69ާ!HTlU&CʅT3LsL4%##@ʥwj|v5, r#n3fFpj TM"Aҹhx翥OQsSqoQ$SbPzBTU b" Wrdz=jeTh[r𦘶E5\u\¤a drEDn1MUb3ޓLcЏcQOSS$9楢"9'qIS#YT7zͣU YH͏ƬÓU7H )*Z+sEU$8Ҕ#Uչ'8늵ۃRЮ4B=zw*c9s( M4dh*mJK"Q J ݅4&\pUxnNzԗV؇0ӄ-M ʶcʺiҺ0K?gcTlm)OZgYlRzzQOآ}? endstream endobj 36 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?Q"}ؖ>@"$[tm#s3 Ab_"%rGV7r+.&UH&6HW=vc?j¦5"B& r9JsF28/H";e !cktSfH|a r*ddvP0YJ-vw}+{u ҍS}Z7m_=k;}C, 0mz{.-pZF\VgP *$ ~th Us+%֫I::V9Y|sHy@XU2 Ï}jV%IXD]glԾlù\}h54bq1e0ǔ>g} Hx5obзVbX,=8$O!6EvGTѠ4m"GZk[XdUJΪ|oY&֖bIXES\@}=1I?s݌3Oz̎{ Ex+1Z_^XDѠ4^LeNdߞZrPVhGF oG.]A]m8[?ya'0gas˜y ٤[]? ve*h.0F0H- &{_b1aco#RX,ɞ ˆJUW胋1w{mKydO!08ԏZ̚8vkXmgxDvx_v;xah/o6[ƝY᰺T9`}O]ϻ5I%dvӥhrƵ-.# h#6('jQK2!:nՑ^ڶ6w7\nM3݅yG :ЬfnA$皘oX(H,{) fiE'؁emc9^OƝq} QT|%>fz-M(2?yչ<DFxFGk5H"#ZoDlZ'?!lM٨jj-{]iU7ILgRǕ3nOk>P7٤9mǨh%Ll #n~tL]=A*oӎRKQ}Fa6oeVa&ٚltMl;2ލ~~9ۚ"97_ҺVkG2 xnd.@Q$[="ms47R g1a67 c3ȨE9R\$f&#AҝЬMe#Xݣ'Bv*̓ BeTgrJϷ Nh_qIwm0 &MTs aZ6XSF6q8$ŦZBkdL܌u'T% ;lY' V9ݠ7-nV>8$G72)?(. $ibyUxu >gxPsr=kZA8X%Nz\6}g&)A\vt9a 8(j})w-U3"ӻ8\Tܢ^B͹\\XBaupA!{S[[5KMN8V !ނ-MB1#y :9ܭ]ߤчĜ/E֛V%;:Sr})5%q>sM&zi_Aܤ`qRz'b\̿erT8*˓Y U{<-(R]*J#i94K(b\B *lO^޽*J^C&5.ß$)Zx1ibIBƤ$ҤȦƇښb[ޣF#p#YFnᲞ $rC`F}X?jZA#* 9Ꝺ[^6V2z괱εUڢ?ZuI+PP "ǏX^s-,6{UrdG-ϛ+H c@ 1K:2g~>Di^ef֖P۪9NdjX'4TYAP3=qPhAsq&YX@3\F2 J[t=6$y&cQϥTu"E.2m#,2ν 8H`ʃ5~\jqW-zW,qTcaBHǢʭAG$nwkk Jpwzzm'ف[|Ӓ}!Vޯk-0fClW5M SZ XyP9=kF2Z$oU6C-z{Ա|\?rw6 aʻ֗Zf+#2MSn7ep2 9;k)`VeYg8OȵgQn=qf -Hg M&6Ei_[,m w#5Ӌ+FK5S#tКz٭iaqKE!#0~qҹ6Pv+mbKi/7i0] Qyd!fZ^WgZZE# rǑITv$(VRFBP*@\ȋ?򨮚h'#Umd||`ކp<4$fh%㎧I7et6f7ASRmISPγaTb䷗I%?#p@.k= a\FL޸ {fAUu"GOɤgQʂ=+Дm@*;Hm"a#]ާ-ܤ?Ҥ??Ґs?e}B=yM$_9t({D*RrkIGz(n5MA@cpK2P5,@#ۊO4Hc3)E4SP" `#͉XqT\whގ6>[* T\ܽE` bC@!NQN~SdtJWCOӊCNHh^}iHyv)h 4Pz\S q)/"8[Oݎ֚kDu\(] 72I4y#̒5f&^ ="Q@E'֘ E6ZZm/zwR+(O4)huފIޗ%2hRth ) Լf'j3Gj14u%(RP ) /jL@)ފZi@ ,+#]֭TiHEQkUr2f!U$LOPXJ7'; N-=멍FP SP?f3oWWS%.=9\N.M*_Y5]?/֭r Ji) ڀRm<Ѥ݅=OȻ?*vDpi^Q~) KLzҰ\ )FO$R׽Y7 r1nQTgw~TZ]pn¦*妔v.ww}*o}R<`T!ʓ#@oΗߝ]sѿ*B? /Q\ ,KLaڏƗP!{RcM%)L u'ҀZ >C1,.x5kh #cڄ'?Up}X4kv #>yiy*0u+xmTk kcҹֳa⓵/j(Gj\PKޖ+}'ޗҁKE-!NCAQLDEKځ84RZכTqPYځMXRbMjf*B)CfqA*V>%۬}T{]@n6mPSqbOEVʏTaDw!^xuն}VF}iԔJ}~hŏSRm5Cy˩um󁝈8>Ye:sVd! 8u[iFCGcTub"9&1ZڳJRo(="JLё@ E&E€0}KߕS?4T@ yR7M!e"ҊAjCzU?է=;H)T/ni){QPc"c^ԔRhSi1lhe|*56߮i%ՠ}Ґ8֤[mC- }>,WZ (BǁϷ\}-Gq df>S1g\خV?ʹDv$Kژ:SJt`:KHq1ݩ-:Rw(@ M4Cց =? )}~PqQړ)EI@Z{jUttE6zShJTz1V1A\ [(V$i-L^@ިGN5'Kd k-/AъSCW'ZIcHd|`+c[)|9ϥ떲۱TtN5YuxHnjj9;rnN;sҐYJ|%(p.@~QLlRź^:Rgy#!lz5(@xls`?_1s4,) GF=px K}:|a?i̎ޓ)1c T%5[QЂ Vf?4ߔ3,lvrp)ґF)O P]^֓hQPPJJ=3E'jC֗9PzP1xaP԰R]8ǵdFIT/Қܗh~LOp7$[}?WfᶞVvjfC5P"G#H[Z Sj ܣc9]mskY8EB>+?gqKs;S)RJoE:OOɸCɠ ڝMhhhݩ:n{scQ@”tP0Hh_ӏ 8/7+QZ]EqdabyS$1IKKڨ;bJXSIcڿG#lLbvZ|\$v=&'BKݮcܡ}ALY:slԭUtǹ`Ir6@ʒݶDގەZN0աU$}j/9`kĀr 8zS(YEʐAA6iM%:f c3ڨ&]cvkAjd>3I0>l_b#yPƌ50@>6:xTIl} J&*Nj &+k!>z}jS.Sy8t0wRld;PݠJBUP݇i `{'ޱwWG%£}?$ {7߼SeH*z V^TgSqqJx/#r{$#hȑ:ZY +U2)? @z0uMhR/Fz${/^* #ie.sǯRK A TZlwpbqKssMI@J⡑NX NUbu>=CwSIjQG ړ◯ZZojN6{1 Oj˽]{n85#L5.z&1Hcp=Zַp6)ҒW-;+[OcBKx. I Ո8$j2i7XKus Hb]$[="s@dgT0&5p롮XxXFH'9;9)l1[(ۺQ$mg| :m3W;C8NaRf@\G G 6EZM; jWg û|0Ҫ1qjȮ25%`պAՈiag)!)V?J)CE%>2@拌L3X5g:j9% L˂NI wmB\r?wk.+UfTH-1g yWOi6Iq=0G"e7Tҹ:ҍ:n2PoqL{}*͘O $6"9Fc&&Ɏ :OZ֋r{Kfps^,ݍ6'ӵgJsǵjB=.l><3Ohǽ=1+ 9{7ք]G4r VY`Rt h0\򻭏[/\:9uF3'ҹK s:PA8,T6F9 QїPhfVTDCy `u.'In#|OyH~w @&m/DUy3"Hx'ŚC^9#h\u^LRj7HHsj $HU"ShM*h(7AZSԮe8$S":BKK6ⅰNe۹SlqKi 'sn7x7LȻW95N/q3ڝ%vry>j̈́ȫ#vrT;wf;o+&B7I,O in6>H6מj┴T ̛{R*xӅ  ֫}}KPi_+\*>Sn މƈ1-0Rfܒ"Cr@8椣i*4kLѫ$tH=)֗Ӵz歮q$R,v#: Xdwt0jrQ[Zi*qn-Id;SDpnj, R9z:,ąbGVR4Zf4Řph6RWGc<1ʧ* tsOyZ4i-8#N:Vv4q *q3]+̼{3e`"T= ڜ _eW+D2*H~nVc Cgk6m+W!ed4R;:PKQoyhl/!;_һ &sqrp~] |,Tڻ=.<֡.D*Zhc֑'+ EګczVEL%qjɫvf RP=}j$:i Sj_JXe$|&ֱ46U^V9r\ҭ4RC)sJj)~POEl`dqK`v@f%[q IL w =YUV PN*Ym,RJnU#3ҦJAIuد$i"YWA>|ʿ^HR]¯3ƨev:`ⱃl/N:ٚzpJackG{wx*Â+uN#7($99=ȮQhPs9m#!%M%ip$Ґ1ғQ&C4`=^ҴDISˑ[A޺m/ķkݵ̡_mq:UfrKC.~`;N~]-5!:IwIcއvK, 4=S6LGmN-7+R@'XKx-n&V̮Qzu2zVBX8$u\TW2+[k M+e9+n| uwN|qY\@_7<Jޖ䉼p2h[KVF_4EUꗜ>I %y kp+<FT)ٻݮ.eHOp+5=VГo۝pI֏KM 3{< 3|@=7C񖟨6) *}os^"R2CpG{npniYaG?RVeԄbޤ[PV5o4o;r{ eT_5;(dFI=It TVaZpK*P0)EUFqя5`Xm;vjžMZZ1U5Cnwcb?3SŬ#`9V#+{ViR(z|{osr1ĥQ#Pi@̶)8O^o.IՖmЉc d}q^C”%gˉ`sgUmusq%ډd-4@?_ZOԸgcfͧ żQ?8dvx†Qg^sӵ,ecRW*3j!v$PЭgctfM}$,q.1=k’}Ez$oyN>T)g?">@l&<0x0ݳ$½OIѴi ))W̼hGmcKTk攖zl`JYHmҤ+ivb _dr>0OlV dWYvo qV-J$~:39G8"^ $l mf~^:ZͣɆ@w(isPs)5iSmVGn*Pp*aRڜ)✽> @]t3V gC.-q:8ӊ2BMHdU?Ŋ*U.vLp1`ΊB9mIJ0fOd|sFKl|+pZB;4mn2ھ7p0aT% K}kG\I۹|5U֕|õS162*5IN зU|WYyzAZAM*rݍkU.荢=A@:[OqZp*w󐜆TV+]F6M8AjRé 2NF9%r2Bz.t< g͹Fn88?]KK[yd ''F&fYcW,Xˌ3ڵ.6o5rd ՝t=(a$!뉺\tW.s [˒JrqI#IP*%7]I?e{+~"r+n鏗5Q؜bi 4 fI*(ḎGqUlUɤܜk76PB{;c\".IRvx$gV:ȭ7nvmmLHXfhFH>kW"V`x5R"ghJ4dm̫CvW"3,ƛ!ܡmۘbu{on(#T39FHJCCon"k4I:Wݧ{8{je.=k"}BR5/4Tд4͕^J%X%y-bCC"ߓ\3]__-xBo;F6*)AncɣwgrG5V{[v"򬿈Ahe*dVdr?4͸w &'GדdVh-np3+OVG^:R͚VoAlNOi4"aa@ŏcd~7Bu=tBcc, +Φ{IR)<2#. e1<.?^Hř19,z]w6V#"khsI'^?e&kh7}9}AI;^î $GxO/jk)$L*z6iH4_۱JRӡ#A*Mp%o2H+zqFAs.`Ff$_9y#[Ͼ߿(c>iN53!ڿ0$`]<uGaLOQXFo=rYr U=*CK?ʬn|K_iDZYE35up8s]KZsK;Aײ6R5'fy'<|{2=MW׈t9,Ʊw-U{tc^ά2{󿋿֡?)Qש}YvE;9ڲ .0*Ķ󼅈sT= 6蛕'CR2:*aTAG]lilU?LSu-tT^k[qԶ?X!vQmZ(:Tˌ+JjIڔRzST v H_$}?nH8۠Vh Ā1n6LrcZtD:eǐECbR^QQMdBS-{gmw)59yK2LpB}+"|OSuplD^I=jޑ$Zmgq3gO $CMxsbwznR^˚ WئϮX>t@#9ҳ$K |v;]8+W:!D1$Jvmb-Í`\4#1O*"38iZEV 7Mm hsբ๋T-rƃҔќVF̕$d]cLz\⑩ Av8ZG#HoHP_;Gi3!=W)xo"ukFzDVh{8 [Zdv6#>-J\ImPXdAߊv F=6F"Tpq`1i뚥&c-=阥8 s#aģQVO N C&qeGeϵ'UHO 0%Jpaɮ/ZHTԏǽGiO^Zն1-ZRm*3W;=LǕLcVχa&%EnI^? Lj!@Hw^hV∲ךx^e]2<7%I/yb?O[6Flpyx\2XzWIڴ ƀ`)pWxjvq-w`3FrДb$⨖VݣeF1PxO0X'pc5S"(|q)AfRpO>Z9NU\iv~EhG{ɭ&IZy9#q\v5H EC.匭QrqFP|Ak V-EQQ)F3@w,'}Cg2q诞v⾉"-b.S (bpDV+Ǽn^%28]$k=9& I ہ!3X.X+jWci IBmv+ZWȲ fqץPm lj.br՟p#r֨Ixr3'je-ͩTp۩躟 Il{s ڷ閭uK HPXGSTNºמ Ǚ$p2Vnc;if;v Mriɽ5#f]/=v9_Yatlbeڠ׏m (w x7eq,Y#zf*weoPjQM.I&*o $T~v+:񃟖Tސpץ(LsjI g&ϊZނ^-.$srjꣷ VtBT$lpAEs[>Cd/9k &zjDQ5]w.`ӌw HG]ܹd*y[A崻 _okO5@_iEʹr [=;Sr)aq96>3t ͻ@RZTH )E%; )jSocMe]Eb AGz ]FW5FvRpdTomw&dOҊ؊1M80h`8{nK68#B<^ZO9=[U!%د<]+{sɳsO>V?]xEM6\epapTyt dv뙶Q&qϭh^@ɍy{35[]q9=SsqwtSg)a+ZYjyHʻHT%4cNO49uW9lSlƯ6rۊlҫ[ӅS&NѶJ֠]! hcms\4֯@M[H*R9;rj[\NdwO<:TGrpГ%#VːsѸaֆ:Ke L\3(Y9m+1,{zO-ȠeX3.H֯ne䝚,\Ȭ ۴%'Lż1N8?Y׻"qoZ^̵cNucmJM:og~o\mI'e9+$C={ g X8mԉҒ/y&.+/O9k5#ο;RV~, Ic0 6;T~ɥ~toIܒntw@銸3)Eh2??ߵU)a^jy\{vGi&J2n2ԣoG a;ל|cYO.I3 d}zM|g-њE!eUb}'-dJaV #ReP}fJ"8+Ӊ] eO#wI"M{@]MDpsRҊ3:h|HH'ԞMgj2]̿*#D̀)To6qWC$4-ppq3KҐfqe'`zԖaCMoe d'%xk\PѹSCYUڼ*-˂ǭ.j|H墦4gmjwŠI,p Q7ַ9V 3<SNlc԰1L-tGU(&f|.n.qqS!ѽy8vAGV.Sf^1c.MMu#43I!ݷ@ީ5U#>¬BqY0ޮ\ U(*lG5<vBy՘Sl$[qS9=8'~jUx4{'8b}IkI;`ՙ/kjxC!POOovgVF20R? Ya Uy-Tȳ4esjy^QVFLV/"3Zʓ[$[,|c+H&%N+c:; x\*D'zJ U4y;MAz$2N8LRQ3%I x*ݶ^DZͮ?ay?a P[5mX饢w9jFV1}'? ;+op~?.V~H"K)aԘ>tR%Xm,LB3${qV4,ф ɦje[J!}<ҵWkDAzBd跾+uI.Zpey3*Xjw(lˣ]f@ũn_QJph^yZjO̺%1FtBeBE9-̹iB0Ԧ׍Nv1s 2ysV 7hՏVٜKr EoV1OHPrʠn"I_$]H2;+K/%F[{k9b-:5?#]unU68d\ ҿ19ܷ8խ Hܤ7:1\~5K| ڱ){vw/t,O %X&M\[۟[߿V?3:,xZs qX{茡5#vmmx_zzހڀI1tYKFj="mT 99XѨ]x(f)meȧVŖh"G#SkQ^olkE'dh^V}N5 v[鈥]F@[r[QD}*lWB߿ 9c7" !ajI5$E WUc-O5딅lM%ku%{#ШaP8V߈5=.i;GްO S((*X> JdryB(-na+fM$Ɩu2H0q7h%kc;Uo㱒y۩Rf| =k2GASVQt$hlФ,˜R.4=g3;E߇RJ{]!mmE>Ғ.I{+?!|Z103Z>}:Ym]>^<\mc=[[3K=:bkF ݌fI2VQWZf-Y/?bk\Ǎ |{x-WVdIfwhTV5C/f e`N{49RɽHˉu YYJ"/-]--fIL)bH`B+@M[LJ&A[֡Z#:4mΊdm8FsJSkPX$u\𶥩\h:ttrK۷N@ pJ젡yb'nvCgɏ@A*}²&(CBQ݂A' ȯF:LJ"RkE2~ּۤN*8ιNgƼ~f} =^yVojz[Ćw^|\&ya*)9?Μ7,O'9f\ J2!FsXp@yQ">*A֩T>V[|nˆG] kRNƭΛBY]w0NDl{dfū۴;o!>%KIQ8\a:RV+2;Q2y y:!x%|9AHf[ Q$G&h$a <5 =Xm. 15m!#95מR ]Td*P"tdڌ Oq~Z]@\`rHXWc(t,XI<:Ƿ,t]9g:^4v2qO-I9s@)Jz[[#}F֖ͨZyP$;lr*z$3J_'W JGV.-2p2aȢ=y d#E; ܹ,{jm<֏zX#/֙>V=Ն,C1xlEFrHDT&i $ӽжsYʳ[HJSv/`mSvyٰB7-pWAT}pIyr84*^1UUݞOK +7~X8UN{OW:% gA ? dj0 hc+ h9xOM:g۽8u)ZT9a*x37 {s.I.r ONlI%ӭol.A#7k&_ nK9p}+U[[En"#NSoYG :}:+Dcbv묾z`K3rI9& kօ.H[Ex* ʔ\1TFT4w DDF;Ƽ P{1*] OXMu{,񪃾.ZV(Ǔ+ 15:FLv 8Iwc&i6 !v ȠֹތZqgctItԐJ4H: H:fmLTk qO/u49*.I<^0c<֘+)#\Xeì}_Hx +$9k:wOđ vz|Cj⏈>_k\[;YTwc>hUѣV1ܩjTphP?'^F @xnqtF9'qA~burl5;+RY7!W֢*76MÖFOJskP=©Us*m(r Zډ;"pUVsӅtȰ#֐Xsʠ IŸ*%y{HE=涭3wgj<dܪأ&?w'YDD%׆͂%9P}3֦Czή5(<}yjhlYՁRK2ʑȩ,U?Jq݌ФA)v3,5'X024mG?boCoywWeF"P{VQ.Hc^F1E*ҺsF۶dmU~R>e枇͚asQVZBG뚷nE2)iF>)|kԲbsahGYw;֚w~W-ϣpD[zEm'J$_޳t'ڰ7R߻ԙS<79,59j`g?2q=ڳ|gY^"3L%!H?K"UOoN`GP-%a5(M ᔺ-cS9$Qi7i5gPG+IXVLUd*}uxPXPEq`s^_xR`%Vl}EҸQƤv1dYA#>/s3{ KcmFYjV1Y38ZwMҡWb9E6ͥX`ީГ?'y>un@H"N8N̾|} Uv쩻ʕO,iA(wiÁ,P#xgQח.P6@j[SL֌kЋuqQp.Q"}[rWF͎2xZ)lW?=k:c sU&p}Kmx+|chr>MzƉ#O)Drs\WX[^8gu5cR*4ۺ&==Ӕ[tE˫ &ZLm2V$vs,q-21"r * WW;˝b;xnt|oq;)t񹬹9N.i\GCn2 pvl7?yׇ. [k5>!$y $ރf֯)ʌ,= QVI٣.|ОƷ-N)SD_25 7LW9ac.R-=kU{Vu;02j.=c?1zV'敏ʿ6;ɽl`k>$i'UfIı2N:! ־$ۥn*9lfmq>Ul9\U5|JcJ |أk~ay,GN=izBj9cY69M=E4MXE܅u+(niws8AS*#II$ cOѼr9$xyLA'G7{46񴄰ε,[<՝YD>/Gr"^"Ic+Gn1YvpFq^ ӼR~yp#}6nac̢Fu\\L=ʾ7R,vVp]† 3P7\ԮM=ψ"O+?ׄGGm70zX`Ni'kSNO= [ 4HX7zƤY?i.<%Fw4#6<>3CXBZtzDK<In:(9!* c3#JTWPL5Gװ٧[io@oc}>ҸY.x6}Aw 20FMiYZ%_h끗q5iԦЭ;v9++"$#/ j/ דIb cڻhuoKlV W jzlzɱ;BPqYr~Ea)ҌIXs͕`FrF!TFH󌂴C1UdFzYrͳuэYis.hLyJz)xl485]fTݭeC(_Ob?bډZ)go\ֺZ1V1thVd Hc=GmP)`Iq J$ RX85g‘)\ucQ ܗTGx+Gm*yTt5,R*Ȍ# W$}-Qf 'gŷ3Pĉn >'k>Ɣ)D֋}i'&һZ6p2sMҒB˟ErBj24pkR_:]$ŎA8ҽfATtYG僴wŅw6I`kxZ3ަNis#φ Xz\Z?4Ty-8M|&hd B ]7C|PF)QVfg[%0T DlGPsS8 ˸ u>yW;JN=v3XOzJT/rjȰR >Qu}cߎt-y$(oOuy$wVg Fh\} -ۥR+ f+p [?inyQڅΡIw};v1OLvSux| gګ`rۉңVMx*G5OVr'*4[6ls.z=PيG"I ŭ#=tpke h#(qD]C:3U'.:Y!dd9dky"*BLW;*yc@\g񤢇1l澸r *x{TpzoiWIj~'[dj-aK9;&c<|MzGM4C,>ZѵYэ뻸Ld޴BV\9RGN  U ͽ[;+f[cq[nA J1*oM?*u} ?)]2cy!uFo"T Ş笆B!'?ο{.?4G 2ެib=ygkQ0+FG񪍧(h,8d_̛%йGJH9lq5ǫ3>4(qV3sn8(I GJA1 {*KTK·҄KpqS)%o[!Fێ6ʪQٕzK. vQccq_Ң6g߮ñbdS f!c^Yۢ:3]'INK:?*ѽh2C(#x7kW)JwN32e+dQB81a}*6G9Vz}bQ&8jўb-[[ڷ{VB[,;TN~|q@8zۖ)@ٖLj.]xnTUΔmFfB5K86c%z͎ L:nkwgW(ʟNaXۣLpW#M#Q,d-mw 33Q*.ӯOA~ =#me\Gस(yVESk@ z*<À08> 9V&.hȑY$dnH4~`2,[-T=ӝ'$U'JX8pxxv9\8J*.J}8`r͐Ŀ{ ZynɭI=1:vc$c$nAk}Cˢ-/ X m-)4RĖ7b8jpn?ҽ:OpZ6"q9Pâ;I7I-ܧ^8UZԟ)lҁccsEz&o ]Z:K"0pOZ*;/P`{{ӴnOVDGYۿcFeh.mI$`t?Wxː>=u 'θdM3vku]/c[ o, rusWFY3vb9bz'V)Sm֍1h >]sC,Tԓ,\ j^0r"i;b5h,p9CŁӗcX=Xn}3 Ef.G׌xcE2[6r+Ҽ%k-[Ccy6hr8ZZmiZp0uֺM7< 8Я~3a,֬kh eN?/ZNq^[m4rcSWLUcag.xV lꆩ~QV`lHJ@n4=(Q-.}Tҡɩ%!Zѷh4d) n?9R={UR^s9ozҕz}jKn~ZϭsLɋ~N#Oƺ-Zd/ah$g$\M&2V7dr3IEB)_u-^\#r}95rHeGR2wf?O&>jߘk&-Z#20:0y;VK˺'W沜ZzlE:\fGg i:.L$zKd@6s߭1ξSdm?4Ӷu E[4a[I Y!ۑQ}j?`21Pt_V]6h1붩KQUhY`ljZ-_/As4?k0˧цFrb[Srhj+q*Hus QVg2'I_`qsO #@qu?J5iXCQ‘Қ{ ŭS˒cRpٱⷠϯgJ߬RpYU[/ӡMeVe/-IszUVr23ްt=xf*IB2՗?摏Tz?ʢ:nI$SK+V2?Za=U1!swN#:|޵.6b2g)EJc6zpJ٤)T"z Rڞi)zfa Eg,ֲLȽ+g?)KnշO& t .n$yrK1&KǷ{dw%ڥv bW޷[JVۃhk9P<+"宬ya-FǶjk81\mmDd&O0ŤrG*@wOfmAwLҷgvbެ{'gQΒRqyLeS;Z%}c].H+Teb){ۣ%3/^ !V$Z6/@I~X#!XBvbҹIÀ~U dyqΚ#d„:UŊ==z L X^c 0܃]-4R :)k.2Ò}bk\(lZ"R#Fr1קNy\H$ELagr;sڅVwnp^$)M̜)bzjښ,hONFnTʮU >ڢ{\|:^} {d~O+>[(cX[S"GBֲz%H&VTjkEtWbsI@m{V3[=L5 7r<Mh)DT>͙72/qޕyoT8#_ f|1l|̎ըb ֱVsh#Xfvc3ɦ?#$cb4*TaN*4VY 1EO[3TS8Y NJ?*"m#U.w}W>~w4sHd h|籨 zT[O,b :4v ncW=۝JΥEۃTw9}:Cyly^[KmLeAyH; cNCӡA{;l\0ʉj?J+2I^_C/ YfAbq b@b>OjuiY#ePOΜy#hٜݧ`\Ni)20=}N+9QE"sYryNX/Z@Szi>rA exs*+ gojqνuTq5x6wT@#!gikx[]>Rg)rǮi#,] Ki>љyߜ~ULJbMuV<fk}ͦ4wBDR ǜקi]id}`ggG^}u{_*,sa]ڙȆ A`|ǵjvfu5:H <3d|ay;Ҳ&>8vԀ~~u>lzVeuH)sA9X+QڲzՎU00yP6df<9&#UJD4]ߔѱl{VntQxՒX'B=kʑOJ>* |P#[LNHPs{< *ăk.953taqRϞ*SҞ}EUeT'=}*`b$t$`Ա G؎SIOZ#*7H!RTnvJކ*mL W%q3I^6sh3~N:'5aDj:SmCvxyW+Sgۭlp)i+*$җ\V<N;ޣ&6*3z<2ʫk4r(QВx~I@KW[{ eD'_@GJ5.f;wiWGA#pAp{WhvWvZqT 9K%i 8E.fu{lc6:VFP?:o^3?+* ƒm0`BN2)]sK%uu*rF:Vu#65XS9 9;@{(}}E*w&ϝ&IL?DcsRiysM/L&Ea?grx?34o=LI֔[Y8V狜KHGԙj.%\vԊuR4T,x?J+ng V 1ކa^Z`lzRj'–> b_͋AS[*~F͇nfnFs,.IJPá@ &vE]<7taN AG5~LF+n3C_u'U٘m3'toԐ=Ż"(3cҸk]F#}#} nYTg8^b|b|m Rն8E_X]dGqnܻXwRMpԢ7AuRn\W8TV!F{V͵vS'.^\lKE/;+)TesOfdzW {H[`f>h:P0m9)$"qUڕ;/24٭hb mD ukN6@ouhP'3! dJ@?:68v a\ǠR2B=&a3~Jqheh_^.%yf٤nYzWf5MZZmu"Ʀ9eoOc[>ҼbxK4núWOƫu$ZmK8Q]}msNj斱s-x†&c"df]{+e#>i$rd*h&{' ; T,4ʧ=keֵ3%P~&cvɑ:S;؀8 reo%NS<Sdh'=28P^ U3WlNjZMYS(IJ.U绎͗0*RvTYڮ F=3\n},qXgU-PTʞ)s 5\ (NTU|>a*?\g6Yf#8 Yxcv_>+m#ۏ\K-HGb:%V2t@Aerg/CUsYko lrN*]cA[7($YqQ n>c8sZ{m/ayk#gP^x'R5 F(R\BDy]iDP70QS+O&"eW1aqǭP-D߈nܨ`S &zUI-H͐ڙg Î*N{5c?Z %k ddTaRҥ,۞Gv&[ج4evXq M8Gux?  J>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 38 0 R/Group<>/Tabs/S/StructParents 5>> endobj 38 0 obj <> stream xM? 0=psm& :9NUJ~sFߛ)< 8 E(o DCL3khi`wՁXJl%wUmU Z9IԁU+3ee?2% endstream endobj 39 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?$)v,Y>@hO>n܀3Z(ك"{y/Imh@̍&H;^9-7tyܳE) F;:yj7.8<0F"y$q x0$|?u:WzY\ӫ+hV$rWbL DI&re {rkR8kWWisWacVQ1ʴVR%}NOI|0?4{[,7n:XMc ;_:]f%Qèa\(Roۋ9Z픪>>𫺭j:UŬD'8 qx*[xzqimóu&K>s"J-*x,l- MW>2t}RkVV$cibU\qmv?0 9lv\C τAEjzIL%) >Q÷H/o,r9}^Bc _Hj;= x!kA!z⥔29,p>^ Q \JT{cbH(v{T ̫ː.*tsԺ}痩Eu"E8l g]vGٲz3FQU[гs[a->孳V@,| brW5M#{]i;}zFX=!e@SBA&|uۓ6X[9E1 C+ws&^}Mv{Sc/о(`qRb"#IuSmc2Ar=*B`|J@FW6㎞(m&:(-@F܎@]P[s_J1ug8{FIڐ`p=*]BҀ"6ϵz`)QҀߔ9R1&9q ~T#[FLٌX+G #TeAsV65 )OSvl;֣QrF+ õ#G\S.[{Ir> 1 K$DW*:(aWZnukkI[r7#ڝ,S&QYÒ*4S+BaHOœ֚:{k`$|{qS$2Bc<=>{cQOE6ItZHM tvkKV%#)?ZPy,ʠ2?ʻc_6oa&\I#t.VwBXB.-.nY,{u@,jw>V zl^]ǗdRo3rQYqܒLtA~U.q4TZfwǺAK쎁΅#ݞReH%q^/OA"=q~U#t⮤phmt4,i-wQˬ\]3YP2gOfZmG zgҳJ|Zb{{lSU/ K)3`sZ,iQZ"l..-dU2-*!`1nvdvZ4zf5O$Qy=}J^v+G UZOͻ' 9?Z@ |sԓR9'I!}QsSH@tO PgӇKޟҐ;ǩF҃fҘ1Rwb(;0(xLLqGaN4@ ԚgoŸ.8@h#=g: uI@oޟ֛fsSTGUhVM>Ip7TwSs]^Zi\89ɪM+l'g[F'aTѼr)[=R/.]&Swg9+BGddCjV|n9=PcJ +V=mFU% Zn[0e^S ǖ`Urcv3Q$T+ jg1a~5Ohb 7F* 0H=Ҝb+F:55[F-/q ycA$o9Oi|IlXC1V[F_kL@zZZzf%Ξ%+?y`'f?O?u^Ŝ,;Q13nj,R; O_֩*8*a$.oOڤq$LTydEHGO#]#yȠjBFI[LaϽpQwn0Jgm"bzwAp (3VSqmN֫Lbv13̌|g?:U3qUKk/ؤ{eDoT,/$N[=zsS}u6'6{ kdتo (x;rs$8a"Τ(Q[Z]2D'SŋO'Mg9(3:nL1rگEqDIRq{:cxOQ:V L%O]ȵK@I8zi4?FmZD>~sdfSMy[͸<J?YͬGc̯ ǗaZruI^Wki]Gu% Fң:ZGg @[/aQăk:~ʲR<1JIvFt!HȲM B8Z)jQ\4eB'Ji}7tڟ:ܘבVex`=OS+E5e*om{_uH x~[6wXpTlW/r J?UQIEW+2XtS=IbIϵW605v7[ruA+t›~GWGuw[@t^2!#hi 36BHdz $2iY1=ڳ<ǖM8 SgҢ#R/LIG84Xgҗ@p*4gހ t=z{sڞxQzn1KǾi4CnA<{yiԽp=S NJ{NZLc"s`3旐:S}3L4CڞG=h099 }y@S:AhգiaaǻU F̀st}[We0my"N>5oyrj(cF#VU)_SGx24/S[F@9t1D~OY<1>8UڂwKІE+"Fmx:\ <x ֭ŻF\ "815Xb݀{V\-%ڮr 3p8ÓF=1{4o Ig#Zʤ.pemrEtn۟bkռ=(n|.o&Rrt1\p[(n g+jxv+[;\ >1 #;ӍDչ3MZ֝KS_XlQa~{72\j}gc2m.FGurMtV=ymZ,:y4TTi:MuOJk%c`xW.u`5ܽ70o(0D\cs/q1|@f)ȪI96%b"F}*sfF::PrTse*dR/_bG,x*NsXZȫf:ʹ1^7%6WO\VciG2M&ko/&O3&M+y9/Ӛjo<7k[pld޶ [K[mZ,Htw#`v#WJ~'Ui-g?J:gҐ}J8S@F"GzSۊwPqюHO4L|Ri >Ӟq@cڗR>ac#}! :i2jcM8@f&V8"?REgolґ+|aݝW\wYN>5[M+G @?C.LR/؅uXeYnZ&Y ErL@;qՄZxrFqj4v kCZK4sFP.;(i  4nKO.v-pՊj2}FՔyFW4t}WV=ͤhKo9h߇JP62n8^K͒MTmR8s'FxyrTRe)VG o;1LxZBՋ`Q[\gbvتiwi#OƸBJz"Pћ3%Y b a-ǽX-liH,HxEs6Zaf%k|#vs-շ 5lՏs]sCT=w^ljuNy2aDX'k?\gۂз1ֱ| ?𤍈:K8/mݏoqW8\S7V#85 iRmI@>ﱮ}E`s=.gT;';CˉUX8? *)$Gv)$/-FERK+#$F<=Ì{jH#[QmV]Zb$V*H`rk<5.Zނ<]xCYZΓ#| ~#R`z#dad|EhIԧڽkE&i [p;d8\d8I͸V( 5nb亞bgmག9 Oc3#5f! ob2G qXɩ$$1:gҰQ jL2!"G9#kKUROg7bG'h% z76}-mKi@V'ּn{^;5^[dH)oӠ#DP;^]% .$UtWܰcVZ͜'+Nq})h-RF2hztq4I" ӎ KRxց?L})Fwڐ.4A9i0ZR>_ʀZL)(y$`u<6i9f$S}~? ^RZ3=i /~4sH 5(>HNSND}!{x#?@7_LqY0+gIxSu(2AT!RTyirySL2sQ]%f%Ye2bolaNgbDYf_jQ7 Z1̖yWNTR>o%ɧiV>6?$j_ֽLucQFDdqzC>0%\cЏQ]lWHwg,G5 r2,~d scwj#ԤRz |-z8ۏγ e:b1ȡf[V#M{:WX5Z\ΎbK{ޢW\Jv{  05iyTJ:vA$ƒbǭ;ڐR4tH; qGӊ8#X}(⎃scdLpJbqit99}\`r})q@)~;Hzӏ-@@zg֎Ҝ}h}s@Fr=֜zg֚ɜOG0Z#. [(v޴$Զ3ESiď!NTcβI i*GSПzwF~g174Z3ָ]3ݐ2}밽Y> ȿ.+qwbq.{MڑҘM9{ᾩs0UxkخcMt5mqGD" &U~"3΢ў!H>c5Jo-d_pc9eN6}\|[Ou냊+[R>ޞyQM^@T"xS?k~tBe ڃIkk]G_>Sc& q%%S΋‡XA݉zp{N r=* T+5g"3gҔT)F~Q@ 'RuK\=v~ ;Iݨ:ip09H~=~c}iO_ƒGր 4i(=aHzsRSL}3֐p(B?AHFOJSxQZFץFwG5FKsڣ#56ܯLۃAdX^N((R }>g*PH1Ocz>4KY^sҮ$HQg`ɩ^dڐښMO#Ҟ Cb`s3WwZj}ڤ~oqFycΎP:fGS҂qސ>zQO֘ JB=N}Eȥiv?(T v>1AҏH_r^4Ƞ8h)s)JHW }) Sywi-P?Z9o$R^+\]uEOjLUNi=*0) ^Oz` '@n!B=k_·'Ӯso|Ctmn$ $4/ZB4O vkfy, .2GBG"Sq:ԅَB ȩXk tʽ~U_i |V]@ U}WPM7%pI>\7D]P~ h~t=F'mΠ1[Lgvs}, P tI2s֏3HwEaLR*|rg.>X֬Zw؟9ܴ+KS4b|}tVݓҬdÚ,+Hgjab?xc9rҬ}1G9X.V)>.8rX OenYr=zR_f}F4X.USdtҋ;M!V>ο?R]=.܎ƀ/9_gp=z~4 hPrWޝN>!|“ҏOaJE44c-K)^Y:ħ?νQG<*?y]$@ u9M2HƬh#oCQ(iw=}|]VW'~!/+w =|Ԕ̟*LP7IRc)@MAK)7Th1y~ToѶ 7F*b!/F}*KRoItޣ7|Q3zߥXF(f(W1/(WĿ4b_h`Pe'X *3o<zMJ̽&]|ҷ.8!U?롨F=ݧ^A!~3}>tK}(="ýsG35ƙt+gny~n H>yqWe#"͓*@Րz% VyA!g+!@ʋ|U6<פT5HH#U>M4^) -@&i?u&i;4PӇ4xP!( IE%-PIKI@(aE%Q@%PIEQE ŜmA[2?4ht|!1ϵ'##ޔHJ>R)i;.p>@3-̃,#b+yI^kK=K+=ǷT]9 ~SHi Vy(?-hA o?J&Oj'5P(i4iM4m-%QI@-PEPӇ?QL LChJ(JJSE(bQKE%%:Z())hJ)h mm3G_D}-OAw_~ ȏ=Ƌ4}haZivC֐RSF;ҏ ;1~q֗)R8_BԬj0']g[: 5ֱzg5W Zw:, nA=q|w:jލ֣7ȦOhV|:oY)kkU8&7 ʐCF?(R@ EPEP?Ze<}ƘJ)h1IKFhRf J(b@())i Q@u#zx~tSUJ? ,Įޮj'U†`ji)jEv ӱ@Q׏JOjwyߍNu݅GlA-9XVoqG˓m1z7Evq-A:Kf?W]AƎȭ7mJE4'>P1o]F(.)|){cGQ@7 kYm#I0D*lg$\`cډk `s?qIyIGm.}eo]HӭGڸƎ=hVcPOKk1o#ZZt35ڏ?z䶓OJ"P|DzOB)F>sSCO"o`7Ǟ#ocF|o319W+,i:t?ſ¤] Vne&qa\~Ң>*כu}ztҮѩšt.,tD#֛yMFުu+mjOnZ֯at0zfo\𥳻crO&du] ?A{+P*򎞕q>jY-v)O1 ,*( LR6G;$mE3ҚG8 N,1ujM'.(TۼIyT~kS/7?fVc69 N?F)n+Ӿ/J/<ϊ#$QI4v%iTS)1O%3bE7cuRӱE7<{xWC<|qf?Lt+qY)$=A` }o׺ׁ+Z`C&ϘkӹZM5c_x}ziTm zi6 Iy#}q!zi hj>!Zei6fm1NV㥼C*ZMreaoc)RvEmh??*6Tأ;M&Smmʒ'&^ }?ʱkKGZmM{^ߤ|O^{A1=֯\^ @[GqHN =h3()z'NԊ3ڒQ)'UϿzPh@RsH*A@ϦiGJQץ;#7 Rf}(Rd?Cv}nQ^]ڽWvPƎja%>KKLPEQE5|A?F+c>z)_᡻HB(w‹8ȿ!_R]_ИRSq]G8RbE6Iyb&)! %;S( +.XfW?Jo'6c5Η{}G9A~׸Ex2!hW;ᢏu/5 b>4Ga;@ON>y 4sZ@x v4YM!S@tP;zHFryb ; sWwarW J~)1]8MIm3b1@ !RpzP"3Iq6SF)?OGֽNTpH5#6~|}k_KTB=>q|(;:[po59P˷j$/PԑۓHsxx9hsQF#ڕL4ހ}h' ӳ}j6Q#E}))*gZAaxGf ?LHG,m0 Ё=IWwx.bc'nWEryT`++kU$D)9RlqH);׭7J{F<$=$Ե00Ԍi@ EPESi(k"Gk5H8Bg Q־/F|{F+ 𳒿ćb1]8ROG1) $^)Āp~Q(՗O#bxnpEg4[].o+$n ?*]bJR`,-rAϷJvܿu (xgx:aOV:%j1.BόZɋĶ̖mɘ$pti #6Dq«j*qnɝ@G@cpJ~*zMfGF'}*͵Ϝ7Hr0{ؤIiN?|O3^/C^ TJ=!_k GmG8dX+ܵ8(?xt\ʿZ-_*ڷ 0N5x`Zj[ybJҗ@> jb4GLfӟZ3Hbv$vP ؜wmO 1MR}i(T;/;ydtaaQ@ EPESJ@!;YeG#]3adž_Й|=_)|nb֯W~g%pE--ns"DqF*a0 7#1sֱ5A+;Yd7Em)GN1rv@WVԡk-) >+X+BO%f9'iȋ^׽M D, w<^)ƚ<ڵeQk(q 5#)V*JĚPk8ŭ˻ؖ @nӭ..3JKr42g:߇g:>ǸW&0Yvuh)Upk)O+kek'>/$#6l΃w?Q^!j3uhW Iϖjv q肮3c?*3sPPS;SW8Pz494b=&>a!?-5`3p0z:R>_))3ڀ0(ȠwG'^h[jBsQ'x_5F:<֙T3N+<1_wƼseǃcGBi5PQE-0(k"<Ć&9C?gs5},pK8?qJ̑3*`8Qԕ RJ.Nlbe_pwƥ \eW_Gq}Gsn4kSRApz#o` yrwKwGqu0*y?ZڻX5D?Jt{;QH |s[ԛ_?WN:ΪaOݷ7v$qKҎpekIC2@E?JE2qwGYc\G$Hc>?"EmGq)#'\Qoi##y5ۈcCo a6q^\cM5q&kω+O_BKM|8gq\W6#6Eu$Ea׊:{OZb&5Uc=:sUU߅ACQҎ?G~ 5loG kq=3O?x\ddw8޵3k< 1}5> nIƘiƘjF!QKI@Q@%-%%p f=nS]pOIG<Є/+zJ_H|g%3pw7I;2Gjk-J+lGA#W$5C$s%K G@|GZhǖ Uy^6<5#-~L qĒA(5ԘEGIXEP?sOޮm(v61Tc_砮HYr+ŒEt:ƇDnF?ҹB&ppvfgmBc O2FǾ uV+de+YlG=o$c2E; HL&i 4DULtΟN|ky_W#:|G; փdЅ{7??ZgZ?!^/u;#?My'OU1?(;Ҟ GSK9& ?!^_k[58pOGT{T;jJQ?Tvr@OnZfp })r13SI9jV=E(uQF}?-"tSA-Nhӹ|F?♿?{5skq3˩INiO_ƽ£;^{W)1HiƛR1))M6 KIK@ KIE-%PW|S?z`W<M$? ~ /kYJϏTZK+zѫTs׷ҹ7.s+Hӵ *8 \TWGJK sN]~tzh٣K*ڤu⹘}mW_?ҽK.y MxLruCShꃌ%:g281%ȡdv=q^kzㄤϢRϝ ǯ1zpld(?k:AH8~8qcL״O1ax`r>MzAl}-ejz|CKT4|ӟ_!_IM |ミj (63=<tbcn?)ωνWk]pKc1{ G$Q*O?\T8pqH:)yq@<~4u9S zC<ҞzΒC=MQzR3I1Ӧ)i/|P;7/_y?.ߍf _?n'Jo7ֶ3+<10Ӳ*Z4ӴƋMi1))i %Q@ EPZJozgzXjOy3Ζ?hBbӟK)?uA\K'Ж|o T\#Fܝq?Nֶ1G)KeFђ Һ2@ejZi38>ɮjcцj߭Fߧ^9*Wgk.A}4.(Gv;zu|Ey+D )r qqUIJɝ40XqXM'p9aEM [8xV.ȋ#fij[M8r\\L;ƧWQrm-6pX{~1s8,G.@]ͲZݛ>ZDC:V>fm48| _Ҷ ˚m\HokS澕gϋuCO \8¼N^Vc^_!ikUl-hSD>njO(pJ?֗?6٠8)}i֣=hh 244v qSsPi8~r+/(DžjY>)?LS[yhLWi=-ExE#W:hƓd=-E&4Nii#S(() P{oṫZKCoY7}enP:r!!q4x&1G#~Hn8&[-Vo.lzwW$RVE#va=7M5Q܏fBI.U[8@ֱ) Ri3]0*9;Wd`H`r] m =sylȼ3Vf8P2Mt 34V HA}k*TdoB.s} >`ґ#ڤ4t!5ᯙ|XsL:bs>&ԏNצxWx0gŚu/tMOlu4' OICjA)$})q=(4Nlzc k;g4Z@g@"N~vi9sގ_Y>*#WYgBMbw?TЅ5ߍqEjf# ,4Q "{n} oŜ%Ƈai1(((4C@ ޼N2W0e`L ?{x!!TӪuP[+S") *} r#Hs[!uvFd@ # \șEIYp` AkFO(]FU^oQo{/I7>ՎwV4)hr23ךUHUtjjJ˲#~1fq,q&\V;ڐG<6_Z׳ vڌr-R'r75dV4 Ÿra}2%* G袧9ԗ3:ʂiiJEk?P>nsYB5ˉ}\C^4?WxFk|Ozpl1\R[k=אޤ}yMӸӧz|c6}iޕݤ?w ތdRSr)9W(9 LsO4cX^08Dnv?,6{ʔ{yIRNkc0Hh!?} 8E*XІiM%!J((J({חP?6;^޼yՈ? _NusN׶^)DX?1kѡ#>CIADrBهZjiXw+,tdvnMIIEI%ЂƖjV?o|ì?k˯M5_ Wfq;#5 3kMo A/tb֍45|uRQ NA2 &:ZB8JzޗåS4Fbphk}Ϝ䜄us^mq4\^$2mlE>d)3HAzҨ@p3J<?P hs6#?t G3Gq=>֓_“ 1ЇҾ~*WOԱ3Me!%RQ@ EPQEyW1N1U(⡵B4!3$?5LWxi{ףCGoPkC %@QMbQE%%4QL w__0jg:}?{Ż |3\Nvn Z]?)x[k{? i1\RFv֤QST?ICsAOA>撥.=hz_AYIwpD ,@.u'CAݨJgWUk;(Č(1&?ɤWbOF>"`Nvz$@cYN8sAkS} &oXrTgVf?XͨǝSqcE`w?ACUgItTƕ43H}O]y+Ӳ}:y\ڐ-J)BW`5OTMȊpmqJ1iiI-(ق3nꎬơ(54q_i_EX^8!/*D FU5/\M~T{o$󮥓<3dUbN*iH@BOs@a -I@xOTcuR9¹#ғz[;d}jU=vƝe0VOJSƗ坍bFFGLR0kVX,mtjb|e7e V.tq:EE"GBg{TćS>K 'zhjhqU>&-4ZZ2h-Lg+MFF]GP?:W sK}^~mzz?Fo11DbQ4 Mf)K*$k>ŨߨĿFmZuZU4^AraNs^V.HZ6Κ)sh3딟ʺg^Y\!\UZ\b(>9 'X ;jAOձgV+1evz.e_2㸮 RAJ̏mӨfA'=j{hQfqژhǵuiz'肛 ƭV"gc3%H;b [\&ƾ) j>T|nߏӰ߬侓ѩ?FA/n.#8֮Y# 8.1ii~Ѻ0?GmOmCTh@b.6xI9\{E^5s?P>jH fǦ^ْ8U_:Zj6oo&gx䞕iWH>"e)97fĶ#E5LxF0 xD缙٪,~ii:j|eC#MD* 3ӟֳnS^ G[e@~rWɮxQ3lIv}0J`y|/_1kJZDyw~\ =`l~htSz=N|E8~大W"/KVS^6`AT4Q򢏠57V )?pk̟BS $s2cMM kȢ>8Q%?#Wmx(g&ỦgԸMNh??:B;;Xۣ+GARGZd_.:\C9YtƕuQq^;%߈.wG=웩fg\|ɵ.vlYgMA▯9OG5f= E.p:پ$艟).e?ǏY|NǾ+*]~U2aui8N?Bĵ:'AxcLSD \|'.ܝޔYHiE(zVZ& h-y0)Zp}i bjCb`ъW  UR\,Qd .Gd),fQQ9W#Z|±`\`A4ֳ4#֓o.@qNNPhnR<j 8ց )BA/۱_+.6NOr)9Zh簠vuaJ\! Hϥ.٢ùE=6Fk⏗ҋa0`N1J`+^L; _E18*[:U(VKޭ`{S1LGN\ﲟzj$ڜ!oJv4%W(T7iLԞ[ڟ(\ ӼjSNڋ /(v*Mƒҝt+6B۹sij)1`ovVAT¡inGav!QI95JøA+ u9>NRppiX.5^j#nB) aᾔQRP.P1ϷK]P1N:΢_֊(@De&zE1-e9*QEH=:_0OΊ(/=:(޿҇Z(bCR=EP!FQKzΊ(oQ\O?:(ѱ2j-Ί+eC%袬D#|E1 GJ@Ah督8袐8?:p ~tQ@ ~tQL W`<:QEg"vNO?xQEC,Μ:pGEQEZB}GT䓊(d;p*"tS endstream endobj 40 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 41 0 R/Group<>/Tabs/S/StructParents 6>> endobj 41 0 obj <> stream x @Dn6{B Eb(Iҝjaf =(ҶjjĮ[#(Grgg5Y<앢~> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?H$Y :gD$?Ta5%sNV~T1Vb v;ARw5kv]v< 4M?FTˌ)yMCXRr&Ǯ;oʼ %x#2W{x8aV3.vFg{AbRs=:ʚ~򪶚dY9^*sm2ݣ݌GyQԓvp+aWs߹$K~JzTqTֹajm*\|٨n{ :+ m0?*VӖro<ʳiY}J%UE  I=`ۯL~WZRg6=Llzʜ7:P[y}x% I}; |YlNVhz̭HgeZc&,A<O%nxxY)O9VS:\蘓-܂0WֺErS4rc*{HХV/KOG 3~U( oKEʕ(OÀ}v93x4nsT:nDg!zʖLARq?*qbǠ0=N4zʟijoz>zy?t@҃q[=ߕHiSH?*{ڐ Qzʞ~ʔ?~TR pU2s\}޺ZM"gֹXS2'?*8e =:ʢ~Scj(Z:ԄASGҚkc1AR`zʜi~Tzʎ=KE7~T`zʖn@?*ZU4򩈨Ƞ Ҋ f!FI< (ALWeNle̟!qBOw,Hں-v-1ezKv=L=+c)U/g0GcbXWg`IyQ{ ^T4ZFgs՘5\ݤ=7:H>c; r27S[a+ѫ wD (HR՛-2٣. mpGqo=;)UqJ2O@"t.iV /giø5Zuylᣑs>+r3Zz?u ɳكI ~Z\qcٮuH+ҽV-CN185λ'}ּr/AbS-D Ws3݈P\vҫv~n׽U6zL7,75kIiDW]6ZO>~EPG8XV'UQ=>R$S^sj-YFsSkjm$JB|W32;˹H穭ƔSJn{Qs"Kk p~y .% jQWd& #'TiPyiMҲ08\Ӵ7CZOpb-[Ġqy'LOSZ"tV}^߂<ӇJs[5x;0#[qH‚% q*[gMr:`Jӗ޹+^x,SIe^ԍ}FC׵*#mYbH3ƹxEu_K sm% Ԏu0k:-7Vr??qR_y7&y`285*ڷJ̭뫩pH`Hl}3 2/_½-YRHfus}\ƻG 41E\J$TTmvhxb4056Xj6[%Vc._pkoRyRܼlf\UoC[zMx[H9 jÙj^5&=5=ʼ!o(P;Vf\ ĈH>rvf.=LiRN-K&c ~RBjwJI(6krܦ$8b{6:=|UT\RިaRMj׭U$9lCVmVzDw-75kI1.MGBrd*gV2\(GR$o-JXbPqYJY`xꍧ\`wE>w<(T,t),6Q,v8Hp1ӁZCZI::2]UcTӣb=*cLx<m`3@9(sZ8iǡCr9 =}Ѯդr?Q^aC ?2rډ[wV}qvgևhzRwjCL !'l?!zOuC=p+… ֚i1=!kv,gbr*V忋$Ri PU~j&Ґ|TV:o"Gu>UZa9l(6s1QNnihǵ4'Uȩv=88> =S]4K9Gv@W4ˈ{}iۛv=~b1hUAy¼P&kYXcˆAǠ^IFe` ?Zm&E֞FZ7 ÊM7L,5Sq c OYе2~Y׹隌Zo!&MIOq&X4yC(R6$< ` ybk>"G#x3pAW:cI\8pOEҾq+qEt: @tpڹyG x bK2"rcޡܒ 1C\_C P\׽:I&p)bSj@8kѤPeЮ A滲]Iym(Ȼk7Z--daX_JXkf}R+,7,X2:cF2;,Vhyd0t#*XwQY\һڼr@6#t;D|*_nRVQADQٽ=jmMC,mp>8mB-296Im-#^\ąʹgO7\Zf/tN\Aa^,s$Vכ OzU-Y߭Ke=4?ؤBڒHE?.s޾:ynCaة+Tm$*Kcխ5 (g#Hq 52O@R[996趷D\ׯQQZx)lpw8fSz.c7F M=JbH>W sF3M0iuk?ԁ<'8ѪTSCEI{y{'f}9)J;0u W$\ ~}Dw-5jY@< Q[_>4j^q0ǞNx"ԟ; z~5+ly0\%cp2qt+R&ݼ3 +*9#;}+7kzTC F94է uhxds#vwHb9!{_߲|a8jGr$&SDn9#q։KHFqMA G󩩣;prH9[s.N ɾ8YAÖw#9Ao=}࠵ |H :c +ὺ1J>RȮ(\N^ţ?mN0A]υ;pVPrZȏ·OߴqAhU7SҟegȮTh$8 }9xȬt!7l;Z¬*Ɣ)9ϡ*;c"*O>i)4QAQ\Gp3S IpsݐһJ,M3CaA#Y72K?#\uIJ,/lr9\ǰXͿxT}Ų0:" o:)2뵳kri^Q9r6O9洉VW/cbܿ"^ŪiB~Y$tw7PKamG׃]THԝzSduԹ 1VpIfe3A攄M =ibSlLPyQ YWi8+׵t;2#;1lgj.#6ҍǘ{Wx [Xdb{TJW.7_ͪypAS 8"tȣ[ƈgC1e>acIL4L(JJZ)R@@)RO%7\q`!&E@"gZ٧(']qoS;+t#Go{q>m}3Eaև|arOi,F]GLdt5 C²>ccGNZ/W~dmok7ncTcM8cum^w}o5so;n9 xנI6O@kC7$׊ޥUBk/f_*PHQ", {ִ4EțbHѐʎ2 UW6&DB)JE,ǩQߚY`Օ%Xf =Tu\N[_z>Ami54#j`HtA@nLeQ9Y)յ d^#>MŸ?LW?cnMӅ,2OBJ>#[bi #{VM>Zo4`zgsN2KFyMAav$mlqqkunQ̥u)#) Ng!hFkgGq  i/O3xrտs겚9zAʚ'Y?tW֫ZI43)thy1HF> _ 99?ʳ[ϱwwi?ᄊ@YjOl&pf?ZSh~ǩXjUHR?"Kq%=$h%Flc954#-HXoͽY4yQϻH@#\%p?󱡭y]NA1㿵q66mCoTu*@Jhcm3wmnr0qJRK,x%FtUneRjɿij.{aX)څ+Pwgڵ?+rGAUo!kyLanⲺߕYS$}Rdw cnC!`rxZW:IҥD"嶜5n6t>Vvqf̰n֊c09x8i. 40և0)i(S( xJ3U, C-,^H E,n K#0=E`92)\(>sCykXIeȟNT+Zچqy6\A2O4Sfw9:nYC[LE 8Ϸ?β4KC.U}WLM2Z|p7}s1'c\=U'4Q_S\w# Az}Mv:mge(J)䱯=Q_N͋2${Nx2FppHPbJOgܒG]iVf t8:VEtu Ubm14Fi̖;qZgD56*GywGG,vhNne!ϵ 5vZݥèly@.$2c'֯ >6U'f܏A{za(T\RTlg.\oXّlDws"OwŕD1;swO-[IլLE #Zut$\զcW}9F喌w5OYE]iл*eyqӯJm60a?^1œ8f9Hą rI=޸OI5m8x@5_OrVP%̶4m=:o ~j%_Etp&Das\bd@q\Y+{9,I-\cgSJy()2* *8ydXR 2IRׁvޥpBp>_+g%\Diw<*FybNr=1]ƱiϛkI𽽗Ē O':yo[yR%d8,}Z'y̤pAOKvGْkKԦ(^w oDP䠳bEc 6q[7MY,wAO.x_8`}{Y7t0(Ar"SԼ9$KIWzI.IHO*"^1\f񴷚EP3{&}gWQg{; 'ٔlo0xO٩M D:|]oj<ۀ>NT =v.L^$T $ˏvUFk_t<}O`5*V"UI7-3M{c{%gH˜=꼳Xf$x;L5kmb_q~>Ѣ񍵥ˬ<,~p9-dg/hҳ35 G4Ix]qH5_IΟ[M H t!k>!3ʫٺ8ZHRiG`2ڬ{I%pyx^v@7/z֤uZFNesnA~UGaZllެZhN+!*Sm`s8YE-om0OpkSEbz[#E2q;MQkllI\Uhz|KxU>fO`.{k*mFHpG'S,7i9>l&ќuybsʤSxCTfASWOP4DXjZq#r"CF׭5`𐓨=Gy<*8nKy)9WS+xI=)V'KnRMFAч;V3nf Ibcy$r+ж-1Ҳx.B`hأP䎊UT +`=gpүj%&&'rg@ap{ZÓs5=>WJt QiZ~f]&4/~XUkbD+O4SV!H`@\6[3F_!Z{P M9FUdg^L1kWDh.M)ĒҼ)R_]?/'s%o1R =~WJh["ۡio|f[R N/&5aQHR亐Oԓ*'ԓufNVEU<(`yϿ]s)DllM6EQ̥ O].]Sx'cu{[j[{4G9 wZdžIT$Qe4edeq8_>ֳ$H;pNg[kvv F#j3xvO!lûɎ@k|5w.nȌğI+a#uPǵH'WU+"4դ:˛KEi.$J7M$ԏs⺋K{KkF` ǿreߠxPK֬9onS(93Wb/v#{׀|eiF xW \ii^Xoq e$A=٫Y4ZUσjݨǴמ\|2)Iea+sěK}aW8K;_ʺ/nzѲz7{{Ju8#{u$fFU _--/hg}BiuYcyU'7^UڬdToZotŒ87ȗZ3?bnϵ@P*o9 3ߌZh14⩩Owz6kGkc]f=I5<<-/PS`? i7Sx@dzW]%t|^U):yяҼ 0CZ^ Dt<01N>h'n;WrMZ)j,kDCW;I*_/r`uG$dEim $JʹFڳAxxo_fFPp'VfW|V!t5Ot?Џ34SL=sZJ:RSEz"X..aGtbMҺR5! hc|m b9oB94h[\kRjw\\,pn=84} *G'v5Xkmd!{=?$m"Ā.۴8A73XM_.Xa1wwjC-Ӣyoqޙ#W^(~qOm8"ª=`w-kTW'C_{#oi`&;¼ƿ /ٞL!_Mv}W;w/8\k?U=qRr:)l2}SM9:J=7= 1 gC@#~'C0t=+l|agR*ܹzY>$ik/6Cau=zσtgWW|By!7}cƗ#b;?sUݣu'A I|37>Rr`d:5";ߋA+*B^i|΍[gp=/ZWrٞ Y!dӻH)cvRAJ}W7E2PF^ٯH:W,;Os)5˱SO+JjrJ%UCKy30?F:V/p)1j?ٜ1x ]+sw#NEUHc-6'p*G=+6v"q~)8j)dX*R4Hv.ÓYrSN]}h^Pu&*$u |VEs[}ꭥRNhjM#~g?e+JkC ?DX\}t?Wo֦ FY Ԭت|7IVTE4185aQs}GoZr0Oҙk ֬㌞\+cՙ#>E/ jq),fVNȼ-an@]UY$˰,̠o?k҂A듑Ulur~(bp (=)vP7IʵLhp Ċ~5-G(W9i%POR։KF(SH$A^+^x+e` ?5j}x|,\O$Ҷ$bOrNM80usښ>X8SGJp=5HQTQK-ot|Ǹ4q =kfүnb8jm/f8iP4S+wWGjX 1[TH6vT ;u*Gdy(ƭa XSϣcpDqӟzVIr"(U91+d2Tpvi9KZ)@JúTT=is7hi ڌdQP;ttV,*Z'p?x}* x5u(F8s] &$U``cqbkN-1t[x%@^ ~䇩_δyX!WΚ/`|-I6qkoJ{]+r wFv'=C}#},r? \F7vy=̿ +%c'Q޾aR(uKȡǔȩ1tRzXd0%,.RE/!~OBVoza++<# iWX)V^znrcʦ ҝ1H/0aַ0_F*c\dԷftdgk`:G2E#5#ɚ.0PWMUxOJͣ~+ֶ̓K= G^f'܍&rj^{")xQZӶu1CxDhaD3tyxvi_[i4 y^7WYi7r,5L܌W+poCs6}&tn:@ִ!ʑ3O5VVݜ@[ڽ]< $v?֫\x?nVLsDĠ}n?B# dLZAX KuNꉀy*ﭑg9ɿPtWv.uhI=E"H'OSh4M1>Y?^?yI^X]?-[ ힵ;zнi̽lIB,0wcEaJ)@ zQGj(:ʞiOKpq\6/-etnT76ksdz $@$8YI צJx֣ka"o}䊃KJ^(c[wyȃW̻$dVImG\fW(wSé#ޖ\KK6[ȷ rG򯝭5MBd:*9ҷawnd,3&Oҝ-)׊;xKb镻Jxi7D'9ϊn_t;RM.*igyw Q܉`-ϚXy7Z~K+1 m٣{EsT3W{];!^Gu5M,q.Ѻ00o¾-ᶖ$='F.U m)FN˝}YZ& _#MunUd#ڍ:usik4XHU_pXO W=9U)+.~;,8_fD$ NA;N3MvWLcSBHI` p{xXnɞvffpO5e*泧23HHPYaRGZ(41*Xam1ިmqZEEMIidke ) ,UyK|K{+A`2*-;#V):';<sڡC}zVE|ǩDHdms6ө xx?}9 yӞ0? 􏅳5B>cOÑf-hzc6u,XLg՗{} HjC)S F r*aM hx縭KLnިGBs)SNF=6Pry${S<!%yrjGvǠ\ sR;c{еT7_AV*,F ؙfIG- !%Պ"E]k?bȈ}ީ~J䞠W!+@0VozFU$E}3 'j1TGs{{UsZ>x7ӅH ӚC0*h$Pjbޏ&18MF y0c]N+J]I UK޻qkKkʢ&y-r޿|cZr߃F;ud!:k"Zg=2XXW sEq MӎjJù\5m)(%7Na]u!8sDŽ/#fǥ)"ۥ/QH1PR94r)GqIN@ ޶2Xw%8cVViWMN%J֜F [A֛.kHN2g1;pKv8kO^R(B{EfSҬvC%Kel%J_HԊF;M8{hQ#Gm.0M'$MU4tՠ`so5x7[떍 IRM tQxcӦȱ3@%֙j-^d\6:XltYƃFy\ JV^>nVUܻzGY5I}RP'́cøE})jھ 9:|+G兘bcFLy?DsJsg|wJf<(|,|@[ YEdCP=Еy\fuEkn١Ye9sqimc)Dho)qt1ֹߴj=Oh p/ 1z.|<21P:x+YIqbP[ rrAYWKsSg5o6Dױɤ'*nW[CDǧ5)sjԤX5_\LI>d>VNJTdAEWIRPSZn25MVI#H[R泩N3L֕iR{V[ZfZ͵j,)^lN+{`>̎Ҹޛ*_FYA:9eHn; =[$kkDwK;?kʠwQ p)Frޕ $ֶ5yqL)U8-d#GZ-(ݜ2$`S3Lp \|dQio\**娕Um {сDpdwHX Y eQ\;L/lT,${lI2x3eFN:FOZr@r8Rec.Fx5NYD6H }O,~[#?rɐw7?O\]Z6.>f S؊dSxHT.1qڳ5uaGU8 Xܮ0[rc3G5Ǡ;E^Ui7*"Fj6LXp+ĺ,M mfx8Ԟt!|t/-EM!ST{ڸd$;T\hg 쬮~0Mw/~ZI#4{ #:cM!!&p0(mEQ޽'AO=R-nxr?^LXҪRJMNi]Dsʘ[ Iq b %HNW#qK$H;Fbj%Nƭ=~7wcL9ROι]KjT!<@*MD2\k1ΚjRAe^~5ϲ+ݙ֛,e=8瞵ҌEd% 5嚭X֎b%Rs Of:==<C\H[a\euzuϝüf6p5j]+G;<k4Cuqg4-2;=.|hf Xךw.Mtp/n?ƹUM-so59n_Z_5o4'=qMQᛖZVoCL:VInfN?1 Ni˒w캝ͽ p6gOc踤< m^O֡fM!JE#Cך#_QE[s+xQکݫdIЅ72;t4ى./?Mrq֨˻=ɯ|vRXQXrҹf95KFy?`T; q**%++{%Ğkuc{1]l_׬: 3{~<ԄghLJkl#~~ݼ3O󫃐GaWHZ5~PGQ\Xw[;۸z524nelH?Lz˹.^6UH42Puah<,)p~ҹhѓg׾"}aY}q׷Zu+{^5GY* Q>y-wA]7'U,dwU[+<~UQ*B[T)PX\D\R)Ag7ޔPǵJE@S ֣1n|Zp8{_Hg8+EkL:RxSZЀFO/n=AMULʽ~Y~es~xqN_tJ ,rS!OLvvOpzQnn}ԍ38Ì{bnNrI<* $!jŶhbGsTjN'4rܐ{&04L]iǚ9PsVSgTcG=+ ,,܃=aQ\@S;QddhlO֛O'pրC1"y9?sOK .>41IiKDTO;M1ԽJ9Mۚc!^Քn )9e]` 0%..Q[O gck> I=GNO]J}@ MHq敎hVhSI@v7 9nsl^M#30K+$ǷX|}sэiqT1iTG);ZS@ t7mI@ɮrq+ YV hN窨8Q{im-t9[ fȎ|G3rS'2||, UqRh,9qHGfOϴ@pcz?ʠMMPs*ќ[1G!ޜfJBk1ʹp֨瞛XDdSe14ook%>iu"VeТ s\ZxEA9MT${$I4bI%*>8\8x1c*ug?ܚlU68*RM% ѲEjxY<i#eAufF 0sCLIN4ڰ4ފSI9MHj1R-Uc|=|r| {zWЗyr"Dw ?ҙ3h8dhE @ ;c+:JGOW i#iISO= Mdb8R 5;kBbH}V} V6jQS&4\+V\ a'کZ"C3ϵ>!m$?FcsIeܪr-~ӡ"?:maaslM;;ғ换w R=0j&8S@I❊QydWiS}7&赴C?+nFy5XuD7Q? L4Z]uuoUH/q%Î#ɪ8(x E4wcD+\GZš$cݏZ)YR'#ih4u#[945HkUYvF%Phm ̪LpW|,}Sskq^q_?@VUGtO5xIº2'#/al!NIӵ#5r%%s֖y2 &_asY]b 4 bItf#ڭi% sM_W/,$WޖGB:T\?bA5)F騗AŽXo,rN0*p~GxOjD}ҺOYMuu>ҹt(ɫ1Aс Jv BQBO MoQ8@G_zlK-q(/O? ]mpV9&i" Z{.I⤾'l=Kxoto5Lj&#3,'qX%ځLLwjO5Zrt+:}13~5izOJ*I zs}¶ E>ԧsI})Mq&cV"m Klr3`SX`p$zn$ڔ6+,qR`ÖkpV%QVpJYֆOҫ7'>Ud r~@!FAjCTMeq ySސPẼ}jIX-O%³{PX}j )s_^FuY 'm'x`N ^/^{P>s@ sҘ2>NE)94v# 'z]E9ҩx2S?wng ?kY&-%}?Zpď~NjGF{Gozjoz!&:}ݜ/g]92zyy]|'Ħ>sfOt. C)h)kC2*9,^RG5 9XUߺiKs~j_GX&5jrr3-oǟCI.=~Zy~hKe+5g'9V᭭+cSWrE9zwѱOҴR$12)8RrW3Cyl)nF ?)j+{w$)U9sW7JkR(d6JWv=!g]E"% I5(f9KI\:ח/&XVU+ĵ;Ce]BxÒ>3Z\@'𦜟Oa!]g d^jN0eU9Uz.0``c^$6j[c'1-!i7ȇqSC|7ܣRsֽcZWvOj̝#3^Q,j0@5AD 4Ӎ4ehP($wҜiR,)W .9-axJ 2_S)#raNKqz_lE c q2J횧7V`7#0A8TnW ]?s2.cׯ׫eǸqc6 篦5PDK`t6N)8&FCqWI#㉋,0GZ8vy'TӬnoo൱YnDrHWx[]XqY٢9')Pb8dhy!8s^z G1ti?׫v-iJw Ҟh *tkS7Hn*{S$Vdv}f2:ֳd]i%gb#Ҋ ⊢O})*]=qL"N6bSRZQt?Jm˨: ֓"#aW'|h<EY ŅWHK)֡.YEzV9`{b3fZ_ꉬ"TJ|x(i0*HHb?z w4)f|qV{`PmЙ@?=s_VMPiL֒& Li-kVFP#iu=\~⾓_|q>rF238SE}@1(SF.GIG/Y=:\Y78 uKnk;)E8nתcT'[L3<^tt)1vy+;J4]q7-ģS^ck6`f7X6\׮`EMbz]ug;{~"Ȏnmߤ5(Z©o;aEm`.djUaj@\cG5.j2*ۅ8IЧ[W|W@\c ⋰ U=9SEs)H̖\ԫ?zT+:F rz7:Eͨewe pzi/m[?*u+}RJ$J܌ ͎&r) ۍJ0}YD0wOXdߝwѣ\L<1(H'&m{a$æIJ3._*#ĸ[r1Ҍ(깕8tu5b4KMjf2|'$]EOKnHd))$J?,Esi ރkcƦ 3U0ŏ2VOYI{۞8jޝ$c+7JfC'kb.Oj7]W#=;0m,hD ?T$t5kCڽOZeRHNqYq&#n)*Jc1F)(QN8cCsR(8ܤdv( Ԍ[.C >cV[0,hԑ\k "{(j+B%kwHQxW;:݇˸ Uq#p4rif^*xaV/ 1 OqDBQz{b߀).C D@=IAI뚚-Q5cY5-W'*9G#~b^M_ԛEQQȩcDx.7BzuPĽyhA09zyČcQ<=V}F&63UG{k_'W)y&;oH8?SRIN 4c=&~uUxdXe8k doEu#iq{1iE @0g\7h;vs#:6D ҤR 0#p 5I#޴Jr(wC)d`S&R %2uUYc8?ds( =l0SGBPG]1IY\SSa0F9>s櫘YFBDfd!1}O1.G^ÊȰ@ƹY<ˁ0&مT`NeMއӶkuwJu3FG;x[nV2F}G'2U}xU<7zhۥmGFLMqsjՒ|3\׍8Kuv{6֩ķB;)?U(m,"RÜЧ9G?IÊ$MV*y&?2j&S_l_p%".~wF/S\ö|6v1WRķ +6HiJ$E 2p]h1ktEq7h qPsx?Ҽ#AqGS`=?Ҽz6sǯ'A^jn"?LW5o][WV>Qq1ڽ/i(Uroȡ}(^d. nasCNSUuދyE+3 9B%@ƽ O&kH뢓,u悃׊kFQMzPN:o,Ȩğj4f$͔Fb|(jLs'ՀlbR1lѶ?! Q"Fz$6=GJ'fokE"3SQij +29xxlU-SFRѦv)_THF IkFHbER@d-'1>UK@ \Dz)2bLS[kd^VǴJl̩n , s,9ԓ+ZI1ӧc"einsT.#]/CoŒGr8eW67\ ;#Aj u8^gަt_hn2(AF=O&g)ew@+]MOڟ1v5i泫t-}iyi@?ZB vOzyv LCsU4eC)D'?nxRx?aoU"u7;҅9F?AaaGE6c#{⻈J-/VLE)>_ֻ{W0kmչK:N())5u-B 攒;cOAc27 ORsWr#ED]YZH|ب 2k[c A]͞`Ј~՘W6rrHd}wW-P;$Ջ03 9j qƳ`qޯ fzNMc}kb2WntmIr6Dj:;^5pS0띩6]if<^ZN!GsnǸ*QTrPLݸX#| 0UW\Cj `9d v"PJy>U<)XT2 0?S]F, m5@5K"_'i7<WUjھ?5#5iu8;uQ1Ȝ#5xPs kr9HBwlv= 9{z]? Tp/g'@AsKdJzTJvjX$?1IN\zsI#p)pOJB097Q7i{"\t"}$r?tߺrciQH1WIz3`Rf *Ը''Z[I=Mx3h̸ՇSc%=X:}k7Qc4A)d?*u9Ž8X-eJ#.zަKqf`(]I[ҴD*:ʏ6 =-B5in'jns aU䨦y@fJB1mBnNj3x:吮=;i㯩U*ra̍{^q21>Qbe?ͯWظu~pjsbzM7zPdLFkCFH47lj2b"9F*YY09lڵ-zVGbY~f~Ӛ&6#g›Ž5sS (rB#\wTC) A4n?@, ӏ&FxT`f3T]~1oՓYf239N'&%Zq":y&ZlaS}8 *,"{p~N++ .~z"v9JlP-#|⟍8L;T{s9#c*qMH"^0+7#@8b;eX O(slQ/ @ʜC4H~}q y~5אyֲBRSq,4oWf 4pӼY֊DXdh>EOdOٮx\c֝␏Ƽbڣ U0a\5"܏Ri{S{̏#{у?4Ii}o S'֐ҟA w#ݎEb = g${Of86*)'LsiQv]7QHdRfYԦb* xW*Bd;7szh":ʁ{;XQ L?Pkr~MƉp@~&oM΄`x NFA^_I](UO,1Ғ1֭E]DZ5qVmWmNOO•sĶeoAO]b~c +66\.%9-g+."Yxڻ6JRwB 3 aOb2Jﲝ_9q [IQXF0"v4:Ŧt"tM>~3Wº;uWS vz9d:4ޮ(m "(pNjc9b 98zgd4I%`Ko@if?(;R)zO!0D#D_1 d.v=?+9=*7RTP<AS}*Wp w3[02A Ĺ @˃W {UL-Hs~tU{K[yvN @ǑRbօ#̸EqK-X*qtp..U\{% nEV"I|΁Am\s\Snў¬=h*DDULlMnz }ju5.X:+Ftc֨!G\f1RmV2D) e8=~"ÞI>&rTJOJF2CtzUFfFNҋ!~yduޕ"n6.".8֤V''eْN*&.I==lgS3 L*&__ʌ.zbХHѪ ~u緷3Ky!RcM*/@+[-‚rffe`I>Yuj-3FSpG8HZޏQI!W0AyK ¢7.#WsQR熍=bH>Sqq*vRE ;T*%H7.,3E~d?^[o86;T Q(8KNúoCv=~&sLLִګcӱ\b1s*F[ҫȾ+&"U)ɨ6}jSi 6:ƕ A #8W P2+Mך#}ɫSUf`Ӹ-\1Ww*T3>Tɠ叵3LNOLӊjqɢ!U->c4a'PH)uX׭ WǭbrUXnǦZ΅@sR34FOM5\!7E:׻6a͢N4M`Xu`q=h.IiGJ+U\chۼ?FwacRdG׭9"9=}9ɕ>n?&-vǸao%d~T{"!37c>Z}_X2 3kcc?ae'ISU Zv~Fm+O.FZ>r>L2dSvGE&V`u4p3Ks-r3Ӌc֓pyn4D{is1s$nX❸Hʄ< rnOVLLrgFsJmԞQI9>#$RiytQ <: L|dTFzvQ,IHցܑRr8Q!yhǨ,E;aFFᝣ/֗874u ) 1~āN3~*p8)RiD WZ1RqE\z>H|ϪU(~oM7ܭ&j 1Tѭ;1ZFp:ZqpNH*I2 o`6(hU7J]t-ZK}[ 9u՛1#8~;`PX~g ,A*ϘdFUqj1֦L;46R *3 SE<"i8E571TY$Nڥs֚bd |BS'8FNT_ʝƈ⃾*Gf6:TދG)!Bx zS$BciS8OFyң$7\ps)9Ҁqy@)Y⌌ʣr^$TWFdW?/,E+󮀰X,3W;0p$`6{iƘ? ^D{v? endstream endobj 43 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?Tp:zTUUj@~T=Ozʝzʞ=R @ {ʩ\A󓎾իd2 o [kW5n#WSsS*`qL'ʣ~TSsHE?*?*ER.ihzʜASӇZ?ARzʌR8 zʞ1?*(AS4APw`?*(%1:ʟN)t~U?AV UhZ `{ʴEsI `Uz/ҩn =Jzʃ@2~U0FԀO*=ԅb=QzʜM6`gǰM1?*~GaRzʓ4k` 0"HE% aQ?*u o?*8-!CN=M zʕ~Tͣ~U)PEG6AT#|GWsAUKg{p1 5/q2Lʚ@ sAUIpOAU5VC@eOJ)dhҥ@(P9);R1;bG"ؤ"+NۃP(~Zp()@)1I^P %-.iAJ:Rf4Z))()Af4ɷ %4Ojsi$T+2t|y([wz)fPo72+zN&f4n@<[2S9FՠRJO vh%%04Q@bZ( CKM'W~%^c1: y?v\M"fk[9ZI>sϭSqRR@ %?m&)Ԕ 18h1?C1HE?/DZ4foi3R7J)njP5@~E05p>(>((U- N OS(1HE:@ x)1**@)8( (h)GZJZ@:ZJ(4U>X&N Zs+'U" %*=+ԓI%x;?xj[iVta ۾nG5JVr?@)I͈viI)Pn#<$2piPC@:( JIEEQERE%54))c\ -'zLRSbI@ SME%8P! %:1i)1Joe%~~H4iƨZj ?J(~})#=< e V5 JvъiZQӚ\R)NMhz0ө(Ju6M4m4Ju%7S(m>e3J4ќ>OFjDcTf5QJҊc7p> AO(Ө- K@6IHZ(N@ AJ()i)RQ(PH4NK@ Eoj) %z}T]jaXfVZue9EjVd#SBe(RqI=YU/C} hy-%)iE%-Q@ ;NROa${UC;/[קaaَƐyݟwb)|| rmϬ(r*YTgőt&)W; `~w)O"c@j+2a FVoO3sSn)ϱ(DHiMIN4b ;bL~#c bFGE\u*1-_"8 '8]w^pm rzaBrq?Fe}W[F*Tv꥾UN&IW{-|?{1#11|0 A})µ$QNM@ Gj(H JQ@ J:ih%-% J(@'iKL.ӳ@5A&W4HjaC48m9,mvICT4SKINH)“ZZ@)ئ?QǢ1Ecl [{Frws%ie :YH`+am+@m´?pTMf"Ɩhqqs4^J}kNufMJc ٞjqIu … q]y2o-șY~?L+Z`+|cg*Kc4X'XmNE*P1cӊ1@LRu$j|:c֪4Rz Cյz |q,{gr7*1Ex||*A~sGA `>R@z(:u6ޟM=hE ZJZ)E%(CM%)II@-k$o%pč#|{g{sGujB*d׊g{Li_wnTWK"S/-*s.tܠaޝ7sďJʏ<z9_@Wv6l׮]vx.XKىgH+X2*;Znx{jƤVeI8*k>K7˸6Bin,rx4ow,>db 5lе#3aYR \Z99<qțF7j{ sj>aremiqcCuwv.^uM=WRr&LpUOGi(\W[$S݀tqe-=}9P;q[޽Cmt%V 1W${f8dt g;iڄ̦b#v=q꺵1L2ܰ1>bx nsHFNz㊻ jƳ$MČE̩6 u =Ƚc<=~-IbHENR Mmdh"'oш<"Zfi1XЏ7nOJWfo/?i s me- o;$~b {ɼE4E:7>wh!ynZx?\R=ZK mu g¶p:ڵG[Z)T<aRW/s\WV`A@[AZzO.o|{1}2k. H񧌠)HSz++E0 "e9(rgD9n<۷zo2Oѷ P~I+lKdY{s+Is+ CӃ46虃v*56gRh#EN;vqSrjHf6B1>{VoEI6ډM-;$ȒKxcSjݕƘ6wd`uzvgt$y9t/ { f.&faJGYFӀuɭ^+ x|PvbǡQ{hѬo ЖH3׽bv F yj #\[UX0|?m%K~dl:Z7̴dh؈f@_NrxҪjHZyl"P/lu3];t1&TJă;=i먍ؾ̉mm cldiHv=ې*֧iY x,֝lM*eÃ$N2Aԓ\K+\Œ:==?̸ud}ZBqR{`Zoa-λ^8)a qǷJ.ZQ"h#l.XdXYQ"0$g¹B:y}VqVGMBI}ZK|Xe30աMT^H2 M .0T~9]R&+ϕAc'LgVJ2v1ځREF(8xYݳEefp@'I존hu$\vPC/cgs nlsJۓs0\^跳Kkq dS?GeHkn3\O[jTd#h My*4Dm{8'D7 on>1ۜ^KTdom F'>ա}]FR0$d0U/mJ-;\zq\FYYUE;s?gn@&K?7E BƢ!mzVtT`fD4'իoq;v#y^VXCc9WM:RT C:SjSkFW͝X/d.qUTcPZu(mȭXL fSY,uƍ2zՆ^{7Mhԫrcm 7zѦfe :܄ yҪRMo-ҁ9ntVm,γKmvd$zv:Vt4]bխl\s߁4@m q9]ig_N,k!}qU[#LxRzSA_9ih c9Ј6i&q޺EAo\3N0wz\̶ȱ fcϥRnѫw@t!ImFXb(qOAΊSJQI}(NKo]-*D̀z/w]*i$frG#ש\ݬW dP\m;\Q֔",W yTW_.{S\fF:IjG-p$u-[%OV'͌sӭi^g gYە*qֳcs eWԙ=թh/9۟`}j³:늱cYݱXqe䕕Q}*[ڕC!Io"XH(zZ_E?3+"m/<>qȧ^JrR8#Fp; vMWԹ-Y> V(%{׽CeKI\n܎͒"Y\)s[Q\][Rk9؈9d8?ҹK6&R>3j7WLZIp'?(kpM-ԃ\uqworkCh\k2n xLO'g5[ߺYT*bzr;I&PHИл КRI7>H @yZ XI&+cXuk98YxzG'4)lr#7pNNZsEkw CRҊЋCR-g:ټ,H2HZiz}}(h` Y{2kVhkFXt{Ku:xEh2t-v1$QypqTyWKoqS^MgRmC\oGujg@ "n}\>Ni~u u5YߍS|C$vvFJy}=>\nn 3YƟ延 _QXϘ# uјỸY$Tf\6n+YrvRAS$\.QHPk}GSSo noSիiBby!hKH?mpA,aACdny[^/Sv:3zqcۚJ ^ǥoP[dO7:g=+L^Sd8lvd0l7sӿz3I]iä&/;H3Ƕ+ִ5iᤇBbddzu-YJ o6Tp1\R<>798#ӸJy9Zֱ5w{ҭZQ3Inn$Қtfg0s@>ƽ]6Z2Y2F0(AR:=뒽]h\lK8f4s[c`pmgQڮ: r,Αlރv zъO$VI d{KcZk?m!"1ǿ=A%mJϊGQvJ.X%}~͈EѦ.f>t4@,br9"4vHS znhc!7)C\Y7e_1f3r:|CNt72@\6VfCQ"\B~&Jyf+G)J2hŨd[lE";a9U] JĞ%[km1}S=zm$ ӯJ؞:CH:5J.nIiFGCtCOJ*mܵuMܤV5>Î=*8 YBrzKCʷiq;avOb2N= x]eۨ>\TОPbJzmF#"X}8ӊ7ykXS9EpRNގ ]!Dm`1'iЩsu=4 \fL n&Tu^*M&ba6~4ĊL.y0w}Ye&!LLA+F}Z+eL!Wbnnl5 #G G{\nM\FĞ!e8ơ>;=b Y3{ 679|Bbi$3x0iV5ۦVSXsx5!JH=9>cDe2y| "~l~0HSŸY_4ҤH73WK7Q9R;4:LV8i =3TAgi$HʮXTs=NRi9kزMgyy 6UsɮIZavIՏz"0bT38}'ZrG!A*?Z̵/%G=io89Փ$"BpxVQlr av>V0H7Ҿ3<3J*EKpZt*k݄͞M AS,VPHe 6J"l3d)#*j)i'RQI3PD΂VuN0"2XF 㚻gɪ.ig IEjgZnsЦTL`zT `l3Ջ68m9>TD|OگK+촸R@%i|$8@8\K;km^{u|܁\~ l 0Xշ }_tvwܥ҇  ''GS%hElnѝ]k;ХѥY&>AWʳ^*A1skKakuq%Bc+;'xn')0 _5XOrRǤ(dVer(`W<~V'a6hu<~V+]o6/'9#N#W60;ȀJVfN)75k'[4RFcu0k?Bɮ"]Bo*)>T*[͐rOAYQZKrS5^eEb.~]{\pp̣guFVߕJ(QڨFK {dFA l,hf2ݓԏz6]FЅHY<`b֛ܳwژ"zt2J+l P IkmpIm.G;(%+ZvQE rl]e*31'knb1ǭp bF 5 i K7KТgXT&G NU9RK&|ecԞcoDCHN;V>9oymj#3~V34kM`b?)J۰ q*04>I8~:v뚭ҽj0\=WPUV9 zک:j}ui)[y% lIxee3oS5')N+]-qek !u^\3fk] 7>R\1ӟj*ֶX~v\QY{݋|Q0)ME1@i[={àR9 vmf\^{+{z1kA­1: RL?#נKϟp5#>~FVǔ7)'XdFZ)R0UB"g"I<BvgiqLdKes;2$ O"k@Ճ"B$c p CU"f}Bdm s~9u )൴.L' iy#\č3=t6Z up$JmXl+kTOѭw,Z[?v$B5fmn79?JúǐbgOj2CbongYWix_t5UYņJ.G=)^wؾZV:<R3;Fp3Y=+Ҽ9 ٬,JE9ڼk_H.a=UY@}֍ӏ;ZjKA1c-A{W,.I/ٱ{VZl% QJ8q,SwxI5tY΋'yiQppO|U{I3ܜ"[ɴ>qǭv.qZ}wSܒ@ _N?Zio%y"HFp/.}61qo4-9"T#8 xz]OFτ'f}I"XY^ ynvI*\q&jCk,Ŧ̮]TW M"għWk]FHv!̆8za=oB=i|szZf%]wF-6vz$uR]=Q{˂VMn]l W'$9?Qqî+4Ғ`i i|]}u ^ap>Y!(s4;]ֱI<9 9'mc_Az m9PKfk);xs^ 1ᵵ)ɱ-=qũ}K=SLңj|w'[ɦ\"JD,9U4 A\pUf.[mׇbtsBőAndoeP |?z0]Mt''ZL|GAN mnR2L3UY+<+=&kVnaloCV$ؚB5E1KkqKUՆC_0Jo VwILVh1J\*FzQ] VjQcDF$tV:}ܫ*Iw[RlkR(j(fmр2ؾQ6i͵gH|ԫwkq}ך f(2WYd6")2&^Fֹe+R1igF'Ub~:Ӭcen%jFDGvߟ]ƿ"@jGcIA%C)X˪$=ճz, 3s9989jP9&lȄpN:M6d}5Լ<`ngeYbTuxZ"aIR0EHeY6pG}jgtuI7g –ROWg5&ऒ7cqNWԚQԶ"-i'tqMtQ^?°u9K͍ǒ}k6okwi"tHָ{mXߝl'77i4K@:< du\RO3 ZQً`cj *{kth-&OC eX"HԮU)M61PO[ R$Kxv=F:י?+M+4;׫xd|/q;:Y #<d;W^Ͱ+/84/<կbbA aBuhk_G$3'GlUHo-v! iZ<9y rZ`DxzUJ$rӤ&y/,_Gmzi Ygql+v P(RіsD:0J^D66 B8!k麄7vLdo+U>g *2mzsV➬Uȶ:C[c?)&m 1ԌcUga\w>.BClc)y?Aڽ#9e*+*Q\;Q6z wo޶|LڪOsld2;dRv7S;iJrltw2 HQڻ[Y4,Dو;9={DԚ_-"yj\C?ҶR٥ "ƘoVkʼg1[8mel yדX^j3VI'y$+>֯_Meyr;ycq&wrh=6q D<=Ev6g6#{nexEG垵ʷF3,ew<ץKz\A?^[IFpܷw3ܰpi(`X }+ʦT{H#.JҴ}9}XAXnHTvmqb/.% ~C::G>]x9>P[j日{$rɰZMNv?Q8H%#!n2;žQ|gf Ÿr;@Xi F85zJ[y }5 K5NNNB_NTrC0٢jI":+%0cM+1U kkzxv}@Mks m.=={Wk։p`H͠' Iʒ3qZxd %qR0n!FyF0/zW omL4lJ%Ef_ǤI.ehͰzٶr0_ƫ*'MJ%Rt٭ ^ dgj1]Ɖ;k˛-&K,CGTo֦TjZRMmy\o'JطvQ5I 3g?*:yǠ8vGk)gbc30謉;-VqV#j|ݞ/[ϧZjnfo 9qa"Ar7z3izl>\ 9T&{f@}42{5 X\pG\棦ͦge ˏˁc@$qTYj)\M<ѭFUHtcinܼ:r-7 s_GA\FQIe `(}%rȥ[{43ܗVoB0%Gp/167օgpla׷QGf)c`I8ǽl8!Š=@jd)* {G&Gcr@~`L'>լfd SZ۞KfRFpJ$Wv<)*!H|גo{j+1rydk_ɶ%A#c%YssyD`z=B8-?J2;tQ~r?i2ǗXG E>x!+쳇SG}O5Rt)F.$??9R.'qvKYrF#9泷2lmPmNH`vCǑ(==tZށZbT+rP;Oy4-!yfb{{N]RF! d?+8}ҪFZsww~LィYgrBK\$E$`=1epd*\֑zUN Pu;8cv?O|֔΋\OC\y `2OSHU}hۃc[5Tj K8֎*5v8 $ ^5ڿC1݅ rG8,=jcms^+CPKhlY1=85bH%{ql7̑*u8y2~V Gs|=WZ4΃<^DRw?U-q бBO'u5@8#/u3۔{enz;Qrw?Xl ؞jeE;Wo z׺T)q CbF#;~n^) }ʰ֊ٜN.i29ݖB2+Rjɖ?S֩U dT?9}tR|Q`H, zWM2Ys ~z!4L6N?kݙpkkoZ$C<\pxn~1OݍR Y_?COW'i[FO3s.@;ZT:y'IvbP >W|Xb6$,Sqя%(KݽW$y%A=F?*&%qoZW23۱ GG~Z-? #Rxb8RtJ\x+ߊѰkxx3 08&Iu#J;zOߎ%=GӵqLTp|ЎҽYbXIo {USL*Tu:pU1ٟ5w@ɳ#h_±#Hѵqkpܒ|l@#RZQ.m_C_ϺtX*U$\ y4 tX..%Rgr|תŲ%(G^{:V#B AaIKD::%*-5,xK\3y(."FUQܞuWKIyȑ`fLn_Uu c^iuޑs cV~uɾnLQeP5 AG6Sis~hr/ XḲ^鋤c!gqo5cZhILK w]K?RCV~ҁx<ːXy6=+)Lp{(۱a&yS0{ c}ԛQ2mϠU-vC1Nb{U )1:#<13KQ| Tma0{W &Ks$L^K crI8STպ)V8]y\9Y~27mɫ_g9&geJqZ ʢzj_IȻc3Z:U7 qA⪴q f;OZ/:֞ۋB;;PZIb(=MSJ8Rdm²u,bߐD2\ Rl,0g+t!9ӎkGf~]-žUyE6NIJMs)i \KQ~r;\檘YW@HbŨJ6G2zyL[SqE[XIBI>&vuK2c&-bOR-k۔-t[U{k/`:g&:2zχ٭!axtrG#JoʓxT)#`Zmis֑C+ CpOo\ikLr鵔׭\!(QN'^26>UY_s3z!;,܄pR5b_©EݣZT%Z3!c9]ωu<D{ɏO^=?OX}BUrxE?ž9`\ll.sӵkT9aeZvObτ4;j̑وIZVϤ[MlH\䜞9R*[^IW ^fP͚ B|Eby>k˚zʏR %ә$+ s{LUX! 2Q?dh>e?{9_0Ipfxm܎[#ѯt^̤2"Af-9#IIN6݋n?Pc\!03RxJKP`k|6r]_ZKvGِ $y۟\JQ=č3qӯT$=i4]W,S" `34SHHy!1Otየ9nb30ܪs,w9+՝]!-I߾Cׂ"2GzbY#"% HCK1A5Wka#\sYӔ$|V%#}SRy/ֽߚsFX{uJTb̾6};6[7uLz^.AUݚYݙfby$&' 7F64q],U+;?ao]Y>Lr1YJyǵD)xL]E(-Pem..n-nEUMz%LJ4MSGm:+;h.|2xP<^fV0NM >gx:%ݤfI'TW]2S 67M&yψ<4&ce9$SIfed3- Fr=k|WgqOd0pHbG$ׇǨU3|6K#q']⹵]NSU\ z:5˂rYGN:6 +g^;dNv*.>,+O1b$35F IdA{+-N=e+ ,~P2팞yX[b 7x=ON288 l(?`T}qRA B4dVuv9*?FfnU !"-܊DJI \wq²nA9~:YxNFB1椂2;a!UN羈F\ݶ+,T6>Uo!=i-#(&zs&Zj/~cpq؁=㌑Ί|=t0 8S T;qA9#]wtf;~B=!^t+?x޼}*,qn!62)OjLO6Svi2FE$}ߊۛA>'ea+V=C7#Jij5=6+;&Z"ǫEu p^+}Օ b!E<`3:[+;;Y֕ yLtq~oR+촽#:yK0*kHc= F`r$ W("L7RtTZ4hm I&mKy# v6p}ZQS-ivz˩%,l}jʹ2A*t8!ty~IbxѠ"Q#[RR[I )#'k^kkhr]Λ4ptvSwʽ;Xy` C6p \T:g}*]LFlC$s/f\Prs>7]8c/^2a::e Ы$@?B"'AN:j[syM,qY#-Jn4UGN8FmǡdK(QwJ_s^͵Ggɶ(N~5(S;T TvR&V{m{/[D8$Ma1mqPQSY`T$j(td,Y5s8r~xG6vfgX{z}*4:[,Tv#cz=苋W'f^>&Z1XWt "<5x'S <-?ҳW[ha)}|_Ͱ-46#`G ԓJi+ =0s֟"k1+bÀ?\w«³z)&swjmv[ }Pfɫ#ݏ;TԢ|tSZR?[B HcB{~cTѡ> ׯNd0B 1z*lr\ޘIbfn}k}Mu5-svKw;]>ܐ2ǿVrG")Wҩ:Rۜ?#T֤weƓZ6Y&bą܄.7Y=œH#\I''+gIi\ȥ)Hmω/xVmyaXr^^f˃NUP!P@e!Y͞q Ok%9w=WgE}b3jhwK1 Pպj͜.]Fkә(g[Ca'k6 FTH4Q1ĥAyhOn.)|/O^?2FQ$u#@*˕n~x' Mk w+q d 9s[v("{tThv Q6N,sG'Q!}Am;PH57uKk'-K55kqGSsJsqqRESrߙFO}D[e̳'rG7i[ȶZ s+2pR;#EqG;nebPņpPzrkĚ;篟s͙8+rMyƋoHWm gUb˖T_ S5;fXQrO4'# Kͦ"i|G! j#NA` ; ?J Cl%5yt$9qtXZvOZKs Z]2)' /ʳO W2jŵKjDr2)fnnc"$r[R#;t57SVn'BatHjXQ ϦqTEdP@#eo\NZk|?{5/6d(:SVXTHsDV5=jVZǕ>XlAlB$jTs=vTe {ԏ0^Sk&6[V [b'-I2ɵr0[u-*d|,uՙ6F+6g\5%VURrGo֚nqmS9JD]&;K3K"9f XβK:amITcqz#'vJ8+ީG2H pNj|heкUX5[UtB(*w }kSgjX'>|z(D9ǽI+fF>{P|)?BzTd>֡4dqj 21ֽ/mOBBڒ0x$rAS^Ṯ5O ,7 @h.0>4a$ z_CDM=쫽Թ yz3IH?V]$>>cCveN{9㏇qO:q$dA<q_Z4{ulmP-hzXdW^3en}3^ic ßJƤRjDZ9ГSš6[hii%$U$ `vכp|,pHg,58,'IdY\ 2p3xqjo"vH GЌVsf궑X4=3njlmղ]b0O\x&}O?wھ ߘFznFm%%>IM!1{R36qEr{iGܑ4U j.@(>`V)ls:{ CҷqUmBȻ9HFѩ5&r8۹)tcF<>CIZ8u՝sƷ8nrp*rKVn wVE}k Lm5cQ.D|qSKz*hY1'uj r2)Xv[-GS.Rcuuh_p7Ӛ+:+$HrGV4gaMs KnC╏۩.a$ϺC+k:囏aџ55.d8[&.I5\IpE'emI5jYRHMsl9=2I8SFP{CEǡz.x[?cm{˛uC rIl\(:=u={)M֡4Yعۨ+(ϕ$IʤoB׉<*4M>;Q:*'qްUKu'vNs :m?]OI OrAzWZ6nopyxǶG+hI'= e8RlFZڔ7(bJlWu,(U+gqEzεjP[&,Ƌ$f '8W}3S[Ԕe-dN*k]UM9Sa> @q4d2ǥliSϦʗQYXv3m|sVf/Rg|OK](^D27^n]Kj\7b@=UyI%Riؗ5isө^qrWzͨE J=(&AOvGon”){VEޑr)QiPϠ&fd'iIGEK#d%O5\-H.1$?Jđ+{2cxWhlm. xuw KwD}+H\ӗPXpx$GIMlc5i4-կ'a>Y(-҂UrHޤ&:e{K ln`+e}T Ţ=ĻXe)4bM4+za%LwZ1YȪH2`o ÊYi𱂲.⫍z8݃=}.!K)2sV$Q:9cJѯ;N3ZҔFcD; ,kNI {k7[Kc@AUe!A$ymrΰL8`8'^UO JsgW{ajf#;`Ջ3RhĆRB§2^&4QRP Sw=Gz|Kmohuc*O%V#+΃rG:OݰVܟQyYw@`#Һ?-ܗ6Kls]n[iMe kp#U7'sbN^? IkG:ރzC r\}4]K1fR=α1RHUNPW] dK{۔y \iH_'4vc'TFgr^ "d;0US/=Bk{C%ŇE!Ck9'}!x.˃zzUX[k(`#ҝ-RZ)>Sڅ݌pDTP\J'i +5kKkҘdL_WQs<(Zx?CkGGxr8oK}KpGEzWFme?z& nԆADI=n o'z'+Ƽx֯R3'$S4* s 7A{5H> U+1u[Sgsݦ+v{}%{.GʃGozA5c%{6)s5Wm!nۃΗz{:.sGY:OC4)O) O?Voxq"cՔTpS#82_A4}MѨmg$\ #G,Lce>fI/ >mor0Ok?EB܍ dyάiz.\BkK/i$Ky'n8xέ-oA{[9)]'ڤ‘X;;cIQ zɞD%Č? څH%A9עYM[j[N)mcG*ÂH#ֱhCI$p3 q;ROZ,#sğ9G}9'w#A LJmh8W?&hh)Cp Hk>T|38Opk_N 庲.BĀ+RLk+y>n792o /͜F豌M`] Wk8sfT74~$OGzկ.e qo P?L# ӒѥZǍKpEcSGz'`:&Q[C:cm1FWQ@xF1I2VKk6CӱwNM2>ct9j)r;48Jpޜ94Zv?ɠ4(()piF)HcqKu>v(ht:ڗ~8.8('z0)qΊJ0)vqځJc\#;PI'++8U83XV:$X4`?v_jdiܛXp+"ۣPwG [F+{9n? &tp]8iMa":i֭e$ C$ֹmw_Yq6~HsʩqIbdOuTzӥ[SSFȎb:d %(&z@jl1ҺE#r38b|@ʳF8X`ry=T5RKfy<;om,3+H8=&-~5=*U(c[gyOᐬv$Hi۹\aO[cx!/)ҝ͞u2- S|XkB@ ;"u|R@у@9%-bSg[\\*? r:?=Hg-=p08F]bŭܪ9?v+խ9$a?\_!!qOVsՄV |˨czI\1P+!kz4&@s+U91\Jqc)$4l0j]2ug!oj)UTQ;*EAN<~T`8Ú\?>/K=qKLF3۵;8~@.ъhʖG΀=93I4 LqRt)q@ Iǧzp{3fy8Oۚv;@X]^3ʻ#sR ;֝YS/S?,% Eb i+׬ Ͽc++#.gvfiMh-XrԞwn8sH@+J{R6GBS3g57#Rz."p:qAD߻]cAX]1,ՏZd%K?AM2s%SU=)@Uꎢc̬~W>xWΎ`9F)&g ubk2LD26^diM]5~$q<iA|p';zŷO\f԰8kQvUiѢFd `jn5 Nwa0]r{hy[{Ů^g?6Եn-O* <8ѴX5 V녑>q\G\3NzS?QXj5o7|C~zcӁ)JɇvchK} kuV|Ѧv!ۏ"K;e$2z[v9=T!8B:r_\YGՐxP *.zhyzP>O¹L4M^JOų]׈gk-`94uxNU̱*-oaդK:3m?OpLUK<˞}Mpĩ?ؤinjFjdةp*:Gg7Ri[9ܙ-?)iFp"D;\Vn?s)chLqǏQ&*L=:5HQG'f(4 zSK!JڹJ%L_ xL7 sF\b'9ǥ#g҃Q׮[9VU< Q/seORj*URaSNz!SQ Qӭ'?\S(8c8u)ud^h19P\QiG4cazR=@ 7}pJ?ZP?ɠdds.?iq7ozGu9"J3J.=* Tx_j\Ҁ(ǭ8| R3֗z'ʃӥ )>nnyю;(@ Iޟf@;wG4Hqצa44)6€=sA1N9"wM5;rhp>[Sr [ᮛp G+7$NzzsU??u5̱;.#i֒ot%DiQWl~wɑJYFVa՝}R-.줊2ޕv`39BYBO/P%EWaif~5*ĀzmŒ ;:jo#;S0kLgLG+2$%,ՕY9M.X7ݚP SڜU$G3Ңl㠭 7/9<ԥO\SH;pE1J tI AgicgmXnM\eqQ2|i\Ʊ}Uy.Ѥ29QF5]ڥ|IEaVswٽ"<06kW&hx0?EvȭFj˶4˛I-o\i9TSf KU\)Ybkue $+7Qd(<B/L5Rir;֓S?_Z;1Jz~—hKx.9axiGzG/>K)' K$)j1~zA~QkrM;n:R}7/z^hL}^ wGZt Q8ڌc&:;@3Pcix?O^vix?o^ '=?:B?.ӸҗP(1M9簧dg#){9N+(hcK22I'>{}v~142-韭AwhfX.F9{@izv%uf8tPA ƫQR9zÌGlTeqҁI|Q<sig_jF@HNV 6tzF#lDkS;Qr{jŷbQʋJd?Q|F1M8ԗl#s}MeF۵4"3;+S R`ӥKqIz.+'Gj/L(XaEHmU22i0iV3Z+Լ' gBN6ӌM*0*6n*W9O hiR EFp; GqҴv ]c֋1"[,ޮ[BayӥXhA`ˠ(܌T!G5&޹cADL4=Grd^sҊ8"XS*uj}*u|PA8RGڡRsԋHdZx@N=8t' Ku ^hM׊8N=(>Gր^Qۯ'cRNhǯKh>ޗJ0H3K둏(pr}?Z1ߵ&:gg(F{){?iIL aA`(q#<\qڗӚ@9QA3N@ 3z3ס(OZ1ӏj|&GO֐ fF0&?#Kז(U,38z9*^>bcǥ7w^Ԇ!ޅ`uɥϭҗ}?:<ƀZjݟ<{Sz(dFPQzʚS -$RTq4gׯ~dFZ-sjOJ@?֥$#3&*B03HA1TI9@cɤ~4x ^֣<48ߊ]t@\R})) aKH':SsiOΔ s^4p Ϯ(sg5`#T3zFO,7/^iʀA==N.3ߥ4}sޙ8޼y4O@Nm0; x)sޣo;X{TujpqHι{ʀ!cO֊d(l`  endstream endobj 44 0 obj <>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 45 0 R/Group<>/Tabs/S/StructParents 7>> endobj 45 0 obj <> stream x @Dn6{-&Eb(Iҝjaf =,Ӷ7pUmSã&F Q *3Κkx+ExTvm (MyXq<Ƨ4P2S)|5y2.5~8h8`sY/ C endstream endobj 46 0 obj <> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?ʁr:sZ^mi^یs"r?Z4)yd,Ҍ8;*M] 5P8@ʝsKi)~T`zʖ~TP(Pp=K8)!E RN[M?tvt98 JT@zʜ1OcԂzʗAP(8U,q 0n qG".j+,NOD|zʌATkPqiKB=%Qƪ8 #Wu-z;+KNGUvp)-W0+;.?:21J:Ӻ1Y4S&) (KK1L֝18[0;?jLn)V! %@)B X`SHh0 5dzRN^4P\WK *9FPZ:{~ΠI9"O33uiG+G}E'ٗfy#R}y'´>ξc?W?'?Z}EfQeGnwڏ Qe?]ϟE}|Z7'ނg*}|-/ƭy (Q+F^2 e. ҏ!W.$b˧\.}f PAoƬ (Qȇr}fƏV)<(qbۿ鄿O/V}g>fѓ1umbyyY;s>y1Hҕ RF O?gތDBxTe7PL)G'Ebf3̣q,g0L6syxgQ[$qa .<s:5mXNM'p'Φri(ZJҲ~}+*1AK@Jm%:IN!iNG)i4M1S5PI* 2=H34cL /N+ T8(]>_J־پl2ZF(LA]T-L*ϖ:6vVj1-t 0FIHfIA8oqZlaeVm'Uobyr91kGDmy-zY0"ÊE,EACE(Z`'jCNHzP#S"Q iW%rҴF<簨 D[Hbnjwѓ9oF}LREC8/!3k]qx}]ݤi,l`02Ǩqǭy:Ƹ-2ldBnnOz&[omuy82D0? [ 7QH{1џ?o_!TSJ[ JGJ)ұ,QGҐ֦`(4l[ApEj,nn`"Eps֦$g<՘ɷA$q"WsN!Fߗi"$8sV}˿gC09NVFmnT)O3n<'?,4*en! w U)7*Ne~>w(zRo'fA aBB9#@opʤښwK`grsۥ $P WV hbz |BdP2T/Un2yQ&K|O@nHUt-PD%xzi\zwO@zҰ꯸Fwc)j81+pAV=5#0,y'ڕ7VKd`Mh_-%sֳ*" i))??̏җ$tj}Q"H)M %'jSI@ EPSM:4Ԁn)MioziyƠ KuZ{}'MRHh>z!oz2Q]Fls]]g-evg"8=(i&vŠQUu86*.=1"֫J0IleS xk놘iS5|̷!)1jZL)i(RIږ\0)'EUinNòa>n~gA|21Ɖ zb(oibvpUR3qnqXP{¹ +M=HO <#%0"m=3SWamc orɻh$0DˎAǒ b;hܮzzv-38S_bhj>>SMjd%%)[ֶ99%f+XZB=**e$Beo@ 5>>*Þrž%1q*q 2i|Fn( "Q0zVX;Ѕ1*ʈ?($}hܖWL7fzZxlu=BHvwZi Weq횒.A<Jĩzj0@=2n;o֢vU |T\􌫍qҁ"#$CLm.ƄGP_>ԝV c>> 9c?CW*DEGA/+xXIRhg bɦeScVb)8WUymەgJV)4BncxcJ. SNl|WqIR%b)!$S$ @ݪ: AM&zQKEYҴn?Ok=G)wRԔ4RQE!INJq 4JaO&hjCQ[AE5uC2ZŇUu*FA5Zmr(ܝԷ7Gu ='tg8+3fɸPqҊ$X=MGM D}š+}Ė&8)+>V(Dyr$gUt<°nJ" ]pÌcޙq%@B3ZcĎ'}g$sCF@ꃺ=j凈HY?t #?қGe;HC6~nұu- M%u9c'ieTo6wINsdّD(OooJm2 +sԢ%dh`6Rv 0+[|>?RV {()sL6kq8Q6>ZO`[(bjkJJQ)+S1HhmaWb{W1V Ns1CϷ#E^;VBNk0ppFPI%d;O\r$; ' )`)`I-"aR0#S$1Xa4;kV98*ĒpA5EL峟jj|210OziIJ0ڠC+/r©I ;qO$DD2nwDI(1a|`*3ZqۿY,QFws4ek^DDLnT"c7)UU/w;#u nE.f5i&fjĖ%8#LUqj$a y*-6{&6س,pzax#9Pr9@84EKv ~UodVbя)H{"-0I)hX[CP)*HTf€,'%GATrLۣszHbOQm854 BiE%8ta@E(@]ǬJw:*$Rh=iEICH4Hh: IKI@ŒRRM$ҬkJ}K1Kbȃ?;a:~Esؾiֹcw(UD_bjx 0Yxӳ4 #&ƨ_OԚDT*oQU*<UGs'3M Ҝ<֤pp~PEyT !Msޖn>"ݜn=kGɨ)lHGϗL+hMw^3ֹXdI6Xnlcot֋ hmBGpTsZE]48>~GA)XȮS(Hc?/ XhlmEM3$U1y<wӣ;vxøJ{gW._:%Rc~_\r-g~ %Rd1/I*\v·0'xElm 6#`Y\ {`r"j8WkiSaq$JO#_+ fAhRP;lVbQKI@ 5&8Tݣzb.EhdɴwA'3k2gc+jz6>* {u3Xv,(?1'q_‘fQ<g_:*Y=?B?3k8Vo j4$mLWc([ x̚u- 9!H9#+|Ckzljom!ԞCQLj1xIV%-N].'qO)޸jSK=bmqOT7f=fG+d:ѬcE(JFڪsn"b1OZ+ڤm1@\z\,(概'AYI?,\^H~LrXT¬IEk[7k׾#Ximee3[lj{qYyD nv׆ǣ^: ve0ݏi6F z|ye^-չ=u\8E 4rCr}#_y m0FaI5Ub%sOXZm2älA5n]2/ݠZ әhXcpOoZIbVF+|Mra&y$ʹ +zW9 EHm\|/.ba35~dl{lw>Ny,k0ZCqԓZsΒ)()ZCP~*T / t*ĤߵycjFoNm^Us#`:ҭTp+Ĝq/[O[֮F>=EjPH֭g)u*1̠F99X[c1^o"ɪ-Lr t,?t(g 5 pCc18<kM4˧[\%̏嬡q|ޞPZX[W;C ]A/*6>p_;l4r^btZnm ;7u$]N< RN5J;=VisZCP7N-"+S6*;?ݩ[=4nijIn1^ =ꆠLΔ},?+xדB75BB+"#A )}":aG3KMWAx+J&Σ\yՔ 1VN9KQ$k()£Ԛԕ7d>( BA FE2L31d.F9߉zTymiXsǷJ$P  `kZ!>v69o %{hT,䮴8[8'4!3H猚(ku|& MykMU[90k$%ܳVRm^8s\Ԯsʡc^HX#yg4Hu0YVž$PAG8KrUav5_i2/[8#(FvW|R`><) Xo.Qפca\Qgyեϕfҳ9k"/nHVƒm_ e[ zz\^%v ;۲ΜyC*J,NFu8#1mx~#}Z3f.ѥr85,`te1+nx^^!&o=޽kqv&llޭ6N+?PЮlu7kb*,njПz盓WK.wZǩMkcm%Ӭr1^ІX#*6F6yˡD'Rq? /Q )/v74qbX^@TrII#;R@ s\ϋOo+ ԓ!ݎaZF-2Ԣ* 4ߊQ:ǩGi"p=INPΐcE,z9& ;+sl 8#ր81OtYiTM+f\q\Mj>"723q BF#­V7wKflp#*^j]sqL}㑘y5W—"( 9LZ.dOX szbO_[kQ]%ƜwgN"Jͪ,zMq(|WiuQ/d78]k!ܷP VL }{ךv[e!v-#?)< rm- 訷{#>Է5Ut:: +I+5P¶35zYִqYIajM`Ȳ?_Ў5aB+hG@'>-ѹ \/m)/ 4 @$wdR(pn:RXգe9PNxϣi _umm?0~:zVmB3H@U1 qWdwn?jk4Jo8ԏLQMj!#ҵq" NM'x/Uix9h1i"`t6-C+uiS~kSdE5j(.9\+m5N^q'ל>SqJ)GGq[LJYCD,I8/f q^vguIڟ2)MDR=F+ "|?ʽF - A\w<ﱳd0GNjF88E`cӜ޷[4sԩL MPXRr{Yk=}I*:)nxPk ziUyt <{qk\V;)G֣Ee>Icz{U 8XjUVlcZNsRAȧ !0B@E;>GeԮ,Lb2*)w { 绺,g>dXf1o6Bx4EY'E>iqee"'}*sDa RHdYS(\Jvl/C">Mݺ5ʰ<[ J!gtm^#ԏ*NhhʑD#Ozt-#V-.?.EX 9y϶3J`h[IZ׺E6Ӷ[2GF5goiPT܎zoƦoKw9jtvSs[{vm&(Uw<2ڱt *k'pWUYcΫry>bw:o>Pk|=jfIձkMpF^JqYrϔ9ٌ`(U2mZ&%&U{c#by}M]6lqUck'MfkctWe]Хy'!prk~!{)%WўO^_{9 /5ƒ&2HrҢnnesʯtnr;Wa&mjHy]2ہoww^+03K=xNr+;EUO\Z6HfS{*LGӣ?p/^kb{K'?T8t!r)~.`Ӽ-_F"cu zWXOv-w%U.VcZFhv,iEp?~W9}8z- `3vbw jYk)mIo$lӯӟ_fPJud%aB*m'O>Hd'O>)> Xn"X!PSyJZ\<L/ǀ?>{WA mczJI4(hkr+TKxdNUgU]"9?02D8ǭr/"26>d?JrA{Ib:ƿ/NFMs^!ψ*KcMaM#'5^r]*r*o6>b)U~1B>`ҒUFr@E/1+]VFHJ)=q^WU6kZ]ؔs9]9޲9j])3WY/s2.Po|wtF>H=Ƽž%ޟ5Kgo O' $rq޽KtL$Ve9RqbpM\ͨ4(HFx=jYOMx#1`ѱZItE7 Xt=8D4&t]Þ L~.!HP6ʿ٥"B$hlFdZWVПRZN<[.FҊ0L%gaœr4 )|.L9,OM^TUZm_[/Ʃ.@hH+p)?Sd@6~(nP8?ξU>{ip(M@rO+obAq֥B#$Gjcx#]` T]@2hŏޕc*:̲?*4;hˏlhR42,'\"W%lISZ-,Q1 Ԑ8h ,tS.20:ҋ;#y̫n;{V#a2\=G\kI4] AlIȻytvN hs\NJb|H67~_ѵ褶7Xmݹk x'^\9ڊ6ixh^;/ q[V%-lb\#d5˿ frc)}^̾!TpzAGLdYtz;m&ʨaXqz͸EH$m@Pq\fo:[KO7bUe#yI$l]>ċ{bWWd9a28q^5 ;9H$$^kx!'Y7E#Nv.YBs$` QՑ/tT3yǾ[dsU;ꗓǗĞRfr~<p%,vv[Yk"Eqo ʜNTX |*"atvKSO$A gh2k{#ax?!Zzr0?22&5e@$}BsR.pqv=hub3'[G2_)+[ G[ʌ/5^0{] Mmt,}ӊqU5a7Jc!G# 㺞)33]}ޑki5@ & #+H\5KW.w"33y˒b-?zYbx'hoJjUDZ9ҔС&g;+e 1ʷ\F?@{rru9)(~d<R0{zQ@^m`AOZ{ɩ^M5Q[#y>'r>%";k+'pWޙWt},10[xpm80y@ dxcG:u1q0zV+x#SC""t+tws*zWxG 53p=z\ysƸ =Btu_G[e.EQu${WxWz.QvSnVte{:wuqdAGz펛̗IlFUCOoJ4:qr95bT@+qRIw fO c5$mDPvndF8_oiO8H3QeVh /s]Mt3ތ8FU>{W>*ѵ+MA#Eo޹OPF9XּUes y~lx${Sc鹹Jv8ϥG.q!*Y=j.Cn|)Mojbx^ W ݏj p.BRZȽNA֩ܺiNGqTUWESvgM fg p+!b‚0;}j+Iཌ<7PA"1zDiDu5\6=0B?Ѥ2%1m }Fz&]IhrvF"?OFS#wLzW#+Gm%mVxzݒ.ֶ9%t3 ó,1ӎbAGķ6!!]z pZdu$Q.7/Otdl2sR>NfLҌSZNhedի uHo@zj:w/1*[ w)敮h2$7 gQu>֕ IMUeOXӎ+Seesmq:]q+]L[zY1iv| j}>Kin,Dd(D w HY4P\+m[KHm]BKޜ 0i²,m0Qnn|#I4%l3^KqhXe,O³|YY6yJ7sZM]֋IqI4,y´|X[ιuMMW_vtI_h 3xaeسU]Ck8e?FuTuP9N'IUd}qu_;dJ9\*;=ʉh sǨ7Q5g'!Ime{)Uj-nyR{2\s0cZ|iq)n:.:sY\&4c".ӮlSM᳍%Xuc.gk@1 vC-2kJU{dRHgi&;wI)|ꦪ],w DDZ5M؛`@9ҊVL)#<)SUZ;CϹSW|9nAts>K#qԌԊW}W T!;UeAR.bF: dk&8QԹ?s$=Et~'# v,Hǯ5?lj~$׼-cņM."cY_pg𣢠QںHieyf/cѲ{WM4sk6b⦈{fKbfKq 9{V)<1c258Oz/{.ubO bfʢKXrmFmFCYRJHqU'I\I> Կ"vH{Z²2CZAm|E"|qT&su=(azaRGP8ZKs_:̐FYC+5,ojM3st'i_@z"A#|'Xrvۓͪ?]0Oצ+Fo-1v>s: ,P+ i^zO5h~˻0SAR\{— O3 p#AS?wڵgtr}Ƽ@ǴǓ]tuSäi?ҹ8 tG\WfO?1?I$,Kc C qgk~MTFA}y0BqnQXg ;m6 ,]YFҌT7?zxx` 猐{#y [ѸIޥA^ UҝVBcJơiS˩Rdǯ֩ID-- !~ AqMW٩).T&_If{2*2t䤎S㱐M=~]L#!X>)G;]OQڬv?AzSTFkʽ#,G֭]Yn&!ʚvKxSSOc>_ :潏7OEePwJZ[, ғ遁$Φ@d&\+J){\ ͦOsvCcC@5V˘h t9gO r` e+U5Desֹy}uepE3U~s\4eTyўg&hqd yXP)qXVfF51ب $%ok`v'99Sү0=jnw Ksrb]'ooz.ײUU:*^*SI$y$nZ)yYKHUp̍ ;*&UGp*Y;E=_y\g]nK!UǴxV߇3 q*( +Ā(#?s%H]+8 egIzL ;d7 2Ӟ(=5UG gHǧ\*>z!Ҥi$2GN)]tx~+uS0i ֕3 \WwFfZO#QohܚLRJIJͻ<*##)'y۲Ür@$g ҒrrM_6q!)SYQZ g =Ci+'dySIW?Y 1 #HR^HGr5Jc[BWDьTgG?\=֖h7 4f@sMKhO'+w=_+GMVlWNmmcʌղ9`:ԂiÊd(O8O^n|# a4_G|Olo܏:1< 56^.Fm H>"h'"P U8i7֝g7H!TI1NVA;=-rä0 ZlutON Ik4N;)ЊhE$YoCN- :dڭx' Lx9Qmnv5.H02w|>xqۃ$%zHse~":,~U-лm(䓁]}Zr6A::(kEV-.$TpXgfClM~e*H ~Z60[03QN1w^"UJYw)` ?ȥ&t Dݺ% WDzV~o{H#8C۸k@֏si:C$c®z,Fgc0u}aSȦ@DAE;QM۴QjdfVN2[jj6 æ=Ԓk)xh@TaqhL^_d0J鳕ӥz_XJRē S7Z`Fa&-'MGvu)D~2eaCH5<pct];ŇŸ~FYvFjwk->Ʈ V~+k&~p **.hR8Ox~Nݖ-Ylp #\g5xTo455bUU}M[&[0ZЋ,N"jsr.6>?x:`կ-y{W|X[(.bvK =VTF2yVFoMzsUƥe#/PbA2\STuE'*YPblH=FEJROiVxXo5ذˌWszF͡Faqkͧ!GSE{Uk#4H!YhpJGIl#^zpzOt{}3ۭrfGv45P&j犣x,|= *՘G!^<fǐB7-ʑƯ|:}^?3vR0OZGc9ny|*}jMJfxt.#W 3,>S$[IKX*v< bMhfnq*}{W&p=^uៈuCm=bmB Z;6Y1N\df#o !,cmn'95OGksi6U]Ͳ"F3\|k̟Sb]FEɎa"0G\:y 1D`@q^cD.;R K dֱsRXgl('RF_Śx>+_Ja-"ʓ;ǿz m\88,Ys{l|)yo$@rFsǥy N'2a<|%3┨u-: zG$c_Ѵqk(=Xª|MGHf!3[C1o&59MGAB)tؗ? UW7CnA(~}= 24ln/4#0Y?$ bI eO氼PVZyb_JYr~p |wzWl71TxRb[Y[CM5RJXEBwq[nMYjP-,vH6hnÃJg|#v#f^l8_x9Wh-Ø]K42!lghy(8kxd>gcE&)$[x#Q ȓ+Nx$X7@a=?[vYUS+t[o}i͆[^*/ךM#wlD\kPAFTdA#7Z,qh=G_\VMfOC(AIeP[>+$r^eEUH 8Z<cC+5uM'O)>·? p04=!G3ucʧp)c@*3IX,WR21Ai^Hർ4 " UYvﻊC?Dk>u=+sPvJJR6x 2ARC򇔪+lbWr*|֦n +#aƌOҥ6p%TV2[jJ~I+'݌6 0VlsJ &WYM,V F7znm8^mpGⷢs*YG?4xGwĉ7- 8ٹCNE[Ee:J`(8[sSi'`q[Zrvcz|XM{3 WYj3iD X=jDe8\VyیQ=2/$-6FPEPH ,eqm-o F2}rJKa8/{Qch|xMN?a#dovgIgy$dcĝi'kHxd*Ϩf_*F>HHnxI.v7bǨI,IQӑ|2/gưkhbi \c'~&3HПSkeIEK' \ŕ2PCwN>حkxnnVpbNN,P06?ιF3]1hnE#iTi+.Z#Ky%a P~jt*\U.}EZH&F{tI7_[<ȣ檼]i۬w/=~c+wܿUdӮ;)ܼ }Es=΄֣OΝƞJ·ElijEgwˉuc &TgzMVGw'q#>Mz+H3>_^s[O+Y7<⸘jԁ]T3s7C\zݭ,L0^Uld @!E#ߚ1+LM|=]( 3S{l?ι3YںO4xWڧ̡S2NJzw=vF+#4Օ~(O4oSJwҥϱS3)ԊVqNڠZJ#cac" .=2:ǻ̍0w\`{.[.bV]FvÎ=뾕58+۞A,s) 'v.!VuD@T]eQmϽqk^ю@jjZ|WbMUS?Zkn6Os{Ud婑kr:vhRcT;p2q W(U.IvsW#G{esY8޽=um#'ֳ%2MĮ:d}Y%Վv[1DTA{TIjtg$$@4`y@c6,W(U,iavI2 OJﭤSGYd<}kҵx`Y@''r:a&~3dyDQӡ`KSJXVHe+};W9EE!V #F#ͬI q?m&M(\C,R kxbSQeGsVm6&cu@8T'O ^6-#QTr yst:ygTv3*K>QE܄z2Q<|Nq7D&*S s2G5p:+٫ {XSl"3iIrN_8%cFC;˴h2tbfB9.oi*7)"+69㔆œd/s\~ 2G]9;բ)]$uW᥈wN=c-C8+R/`eA 'Ϊuc~Vɥ/2WԮ}-)"2I+CXI41Raqdm&l0ֳ8-WdEЪ!?UFb2zѶ?QѿW^PK#G>YMOpkЯFzws!pwA8"a֮ze2:A 1V]@ tޟ) ѹ a2 |zW-;k$RWC^v9 ʗ' PV&]ϰo?Ϸ}<?X28ܝz5Qr|Ar9"8{c#"GU[cB!eOJR>#ެFא}fS9`]YGQU7uv[W/Z>o6Yx?N_i,3'&Up{QZ:M9*:xoʊ5``NrjF#fSpj~G͊P{v)p1L` R 3"fXniIyYF0Svh.ZLUqfqy. l^ifLas95Tp%= xb+9Gb0of-3iڼ豲G#޵@0F=o-yЇ#g~5cMiaV??~DV} *o)ʃ9ԞPϵs7"'/hLV)v4yxO HԳ}Cr߇^i$"9%|ZcZ驈HA$hA4 ܒjeZOKPOڔ덧Rҭf`LDH?NT"\tG 4/5fA+[sv,OZ 朑=Bqsos>Eh>ӄd Bbh¾mLsU }Mb[{F呋o\\5ؘRhQz"=g1-N ( TvЉprtfx{GICLI珺;B(F[a*)QjYou] |vg;StVUM7PsB[]Lv21Zm }7Xl|B^2[2(5 +)[°&łvIO )(|/5z;~Uu}ڑLx P#늳0X0h԰'͌Bc{jh47[hw| cS ؜`UL?9'֯BSwf6qt!HKa) wZ.N-9 '.3]9]G?j\ێLe<߻2U}?$zv]>T ZE̪8h5mV A#52٧`2\Re'b5b290' h~gaY2ޤӜ1 )JLE,m[y xUY=K`)OQX~ X޵hNJՑFVT.yR1@\[q^-$dرܴ5Tߌcrf8\t\v ;ȥxnUSq P2Fގ?+r{BR}G%l%BÑ#I @\aƭy(ϡ:"A\htNL ;\ñOx s^qqnNZ5@?]E$hCnyǩJZSͮuѦU*BfҲ.kH.BP^w4Yr:m Y@f!v1,; au2($o#ڡZɢkG:B__H3 6|yf>cG.FnWiݲB2VJ!iW1_.KhD>FWf!i7g+ֽ+I$pk-c @*)걵m ?i0o^_xDǐ~ieII$F5OR5ʹ6yb ?yXNp^뿩FMv%@vx_KD]>&Uw} "(-(Eà )֊M4MZ2M;Ƥpy <3M a}1R*)iʵQ"񷠪ˑO5W)2F+p<9>d:I.qPauBj)e'4F99&ӓMog8ނâ)ϵ?1IN<4Lpp(fTqMiPg=xa-ׁ֧Uɫ vCCJ?(.TQ`s.yH?AP&:9Ԧt p:TO\9B~Q}L0CMM$=p*%fV2)013L6eӭQZ&fʙuJp@26֬A ȫ v_ԩ갔 nQ489]I2rr1ESc۽>|qj6?שf86c]3}udGft֝?R%Ł$jGRH=f]7zjfzi/ڨ6^Ad?fg cg v4b2|=w>ۄ>hi??-9lȺMfp`sSA,\Ppx+Gl\񬙊%rTcK?cit1Ƚ?}ݺ^S?*|k12>QҒH8E'(vw4ЁN_?A 53(Vn`NďN_\x+5U;4͗56;A̶%\#[l+5@O(crcnVWj~d^4 3~ POuZˎ|M]`ǽ+-3?Ii?wsm5U/o| ܟTl.Kv>jC;Q9Ŕ/MuRGrSmhZ,M:({+\R \/^MFq9TFtmEKEq XԼzgD|C(ϛ_>T}y͜x٢;ќMjxR$~>N:$!<橵lfW'M3[jAr|4.DӴ;5N(jr_ėvy4ķ1DOqsrE(\ME$nkh&5-8khxy)l1<{Tp Et͜=¤]yßZ0Ir3o^i B_j[.Q~j~&ہ) 5ҝg G3>)rCOLD)p{@cd{us>G$\SHjln\C C`?OFN}Rqhi%NMIpkgɬ"61H5H`XEW){%{i)E@2>#ֺV֣F*l#?_e#E 4|ȼ~ZeG8H#pcc6 -OKJI0)"@eȫYFZa#`W#R8W?gv3ZOI"wCYX=ALNEh.24?j'g:l?i: gٕw9#1!que`/oq_Wt?l2CAQ ZyOߡ4\Ul?cfT# *OڧS0?O? zg/j22eyx2?xy"Oצ`kC'iki~Rp#SNjjEW#'ɔW>`dΔ5{t1y?ՔGғX`ANxT d1PhfAS~i tc)AG @r*jXPeU֬8jAkNdR'IIQi>#,2v}HV}W.\vV 89Z291TMd޸yS8lp*>/i 2?=~ 4Zjy3+P 1M@ۊsM^%t>zI+RdxP*oX 9ؓT}ơRKBOrl|I9jdECƒ7-h?2=Ķ-1V*d?"L0}jp*>m~ @O54'Xac5Kq=*sӽNpl/+;R`ivr*8#Qs0'#=yb:M۲{TPFۉ#=dtgF>&Fz8UN~ Rqsjm`V&Ȼ}*x늲I!̼n"NP#ƥS1j[)92)AZCN:SX kE.q8aj'5M՘~ c\'4EMq~ T|dh.rE6#~cC]H+pyUrgj) ӗ^ց1ҹKэ!'cjXIG<٦Ƨީҡ_3~FӏC:795'梓;>_ҙTs#P!G>O*wR#`Uy>y4t] )5FTU gg>^x5"[ڕ 77jp8Ͻ0=ri2}?NG#2FuX~ !qS[S4!;*$P#چlHIS!aqӭGП?LyVw~724MJBvI3ڇ9U,hr: 2C MqQr"19#j>FϵUv^jqT̨O^@H9Z?՘RjiMȇ?L¹4E8R}Tcp>OT ԣ,O33?*iG:\zQʇ߱OGgCßbNVRA߲[܃Z}?G(s%a^0)<)>p=;qN G֎Qs3 T)|jn .@fV7rҘ#e;ߕl=}<Թ٘deNGdGQխ)r}xr;2zPҗ,zV<ԣ:槐9ُNXsҦV֖WG s;*hk(1b ٟzFB09/&.50GO0?*a=V(&?:q aP>N[cq#)vÓLO/'=:eGSLlH%E>[9LT1E7kc;SQO9ʋ/N6zҴSX@M0;F>r r@50946r0(W8'Jd#MMYzt!`A9䁚b)p8P=sNTKd$ R6cϽH,d;sA|| Z4xhE>Ҷ6G2h~rBdyC͇#\SSIJ9X\H `?2*oˎc6yaRqcSDN zG!>1wJ<)O8=QΊa[LQ(qV@)oA=!vj 8?uOU@j+WZo 1o?J(QS QN:{"\SצZdܓ֜=4tap}qH.(ӎžь1Kzb\~:~hǨ 3={qGO(\w>N;I: SP3NOZN{c@\P0: \w3ߵ/>4q@?ip:ޓ2}X.iq&qi4=xӆ=I)G*,x{Sp}i8ԬjB:ԽғNO 'ڐ:ixbj,Nhϭh;0H擩ޔ?JA`?:SҐ0 4X.SXw83"p qG9)I+RS?JByQ`i /H;G;w~rAi8 v)Pi.3?.1Jzߥq !nsAF9#=h ӈxK\#zѓsIiEqu#< #րpF~N'QIP#׃IR`}F 7ǥ GJLyuq o9nԇӽ+ȉI׏ʤ#i1;Qa܏=Rwp>X.FOZsԧ=yqu4c_ZC֋E97ps뚘SHg4X.BHzlFXǰ"!qh\NSG<ru<\qR{Jelx49F;O`; 1))xofOL怸zzK\w(u+cq*p?MǶi䜜89=@\v3?^h:; zTz}( zi^x(a;9P'>ö( >r{p[ӊ;d*Ap3qN'{SsN@gg?J:4~('8.;!9Gwmf>Ն r1Hd]nh.@>4Lv!`I\Gz8> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?֊5r=*tIjxUifN6Җ=jzy$ަׂ="Ȉ@*;+>q]E)>r&ȉ@:`0i@'ң6eA`3ހwtq2)"6FX^s.AhSj6S=.ѮWijOth]T篵6U#bpyvDe),1ܝ)M y#< TQu`sQ(2\,+֍A_ˏՉdm,T R}E_HjѦt~ i+,bW=%VF5$/g[ʟz&n1ʺ4\ 'j9>ѣ`\~Tzʵ\DHg`ihU=K?*,"wi0G֐s"Y67 ,5UѰ(- LARzʜi-P=NAP)M#"N= qzAtkq~T?*QḴASE?*0=N7~TLq@zʚq 0h&=N!=RL=i0 g@'e[zWx FOZCs9N'p ]~Ukh9Ҡ`A8Z 13 Qi)%A'@3sI*p?*1 LC:A}IRǰԘ1~T'p?*Zm1 AR`zʝ(AQ?*}4f>"/'S ʦ=iqH(B=WjZd@u(qeqLo(  L+9l |v"cB7-5Cw)Pv!aг} S-&f`q7p7`a2B@! %0E(?gV 7E8W !HQOJbq +w0㊣p6R>JNUKr(T[J0#5Ub@=jYb_ < oC pB:0FYfP ‱$neb +Q!`)cIǘS3z!@l1HHcEd`,mnR g?޷5=̪lRկecDk*#,;~gI%* $QJ]%7!jA⛼"6 n v5-Wyݻ~PrC.ddsZJ4sSJyI{OeF?.]cޱt\少F@wz㨬:黤4KN8&("3KE6iJOڛ@ nNUK(\yJKCBqFj8TWIěc#3 OJUdGp46}f] H-e*Ƞml$==jH.#_,Qf򂳪2iα7%&HԞ#|=y+VϧvT?Fх]#R|iJcp#+)#wqPJe@h <|zx$,rx2@2z}9~ n>V8[ҀXP, ۑS`JW2CP+1{WidW''"m%IǦj \g)J&Si#qP3@_}+YQʂu?xj bRFɟV!-mc@|2*58+k~38=Tdێ9깈ԖK 4#H#׵ZxѰ6`swG7 TBUi(4KHcץ`c?ZZo5ظnFB+ h\P9[`:/>jc#v*$Y뎄.<dKz g=Kq,є y"O.V_0SiYl7Lp5|6 mN*+;e,˱K+ 'f3QهVX+*<-ქ[GWUw`#ҲdQ͵@j +)Pp&tl؞* @eΞT0Tc6{K=*"q&mn2o9' 2撘%RPP(Eo-a?{'u6.)9mE- LQZJAM4SOZm0ӉD)& ;p4LC;E&/:{Gi0֞Uv mի(u#z+v{+VL?ps_q]0)8s¬)"Y[˩Nz6;}=au$܂@1kIU4Fs }jUo'ֹDw(֛w,3Vv4Iwuh4 FE%8q@ 4yM%:(ډSɨ`it2(\n>K !>d:xBE.84P#S M1-U2XYObjTIio9p X]'WrUDG-ґA.ܒ\XIV-pp91drErʰ#[r;Uak`frzND:ٕǿw#VywbqqV46]Qyl;ĚChAý ` `S ̸EA(L#3,֋Mc,[ʖ}NneP9Z6qnܩnr=&Nk),  UKKݙ [>ace+1O /f_H( buĈpzp>aZij/s'F#֪WcQisIA+ZѢ37([Tqj9C#|p(.ݳ;MFy ڬrG_ƩZ$ 2Ok Z38-A]zPIWF;S- xHw1ޤg {qV#7RxCPIvJ@h-#QƂ)HaF(z$n-bKOEM SސSdj%%-%!E-%;VU._SZ{TR^ֳe+[rA?[֩U)liS <$x(JI^izf%6jsؐόS845'<Ձ{Fju{sz{YxcmC{z/"QW~%r.V޼+x(87Q .ƭJmqr<~A ߏ9FVMi}Pqr,daCt' 9&;<'pwn<{xArrt׺|-ȸ.vGj;;^KЯM#q%&RU͎E/cTq36=̓$1+:I̒bC򨥙prA4d%'iW aR+o5UK$"@[ԭ) 22J9v1m}l;,6AޠfLniYAUjhl4lz; h%GYn6ι@lb;xU#E9T~42/,Yp泦A MWsᕑw0=Vf=.7hrƤErOE^4s4yLTټ<:'*ܫ F ̓S  &I$bU<1. |޹BYp2X!/48`<;0\=i2HBU3&1QYXv\wV4L^DATMƠp)סR>;{n5q,f8RqslrONlg$Ե9{\Z86R@l msMT!p Bqޭ ',Z96Nxܳjt.jvE"U|7yr{Av.T@[8f^aqmA[5&\K- y5 *DT"bFNjH(F< `v-EJw}ުUY]*ȵ\PRQEP0.?_mb\Կ 7VhK2pⰥ5+ki)m8P^q8x}?@G?Zu*}gR LUqOqZFjUv]O$j$?#.\M%BXĀ9)k[@KS*`q9$zUhoO$j%&k#Qh@4̈́5& IZw_Ya{IsLjH): [)1 %Gi)"D¶bvRFK hj72G bTR=EeurJO4Fr Ri[~6O%P̯ej /rݫNo90n"#ǧ\gn݇!Z֋SϥRi/>o4SфBW"{0n;\o/T61Vw)6VPvV QҦ}M= D?Zs8FL ZUTZEF=@Sx @dח' 0L$l.k7/85uN[}ER+'{~kOYΰMh l's{UԴZ|bN\`!;XSP:$98Wb4GWLכԺ})R(St;35.U$P.ݏsޟR4t?rVi2g8[A-.Xug_ey !2Z6R`dXzW6V:$WfԒ9`hibj^§N9t`Ӄҡߘ-0n/4ӂ)׶c rY ۆ?z/"\ڠ|LwS\ƻT~l[FINږb2B? ?/jC+溍>BrtrM#~#S"8^}(@"iX.:zē z k:Pf$`A NJQIJ)X HѦ݄{ӛyJAKR9^F}J.JA)_*5Wɞ.ulZ?)Y"l7 &6LGQZ dY(][OG>Ա=K>d|qV|4g{D }$Vg ٔ\rxDāqQ7 zfYvڤ+v509ReE+'8T ?SKRTMG`P)ۀ sTMۑ󦛹6*qҥܥEaT {i{nYA-3횝JK~ʭbJiRRR()E k>|%JQSbsg :gS(O#mV X㶎B*+(篯5ݶtФ32/E2+˖M--Lu'ΗsIΐK5qrµdVG\֟wyZO*H&DI[\t$737<ʬ2j,;9jE1#m:X̶EozV*~3\B-FYE&+I2Kx_#"f!Ǿkidi p;C:p"9 z-,oV3kthi.:T 3?)~eNC QB`ۣ3@2}w[]T0=zGSjZͥ\G4/bui;8?ӱںKUlE43~knsGc 1y4.s5B-@Xz=()F.2[dj98<{Ӹ'BÀ柆QHj@mV"q b16΂4y%aM(|ڴl]ei>Rr>jl7d2;M$FBʻ;~87dSփ5m- l!lѾdfKFrr+n-eHh&0犖$Zgxɒdhȅ9tSvqۤ,̪w9?J{[.LWߵYoSZI9H9MqsxJ+ b;ֹW~ymH'NMDDU؁=jZ3E=s`nLޡFFYb0 M^9Xof~^=G<՝zɽ(+9\=eJ H6DEf ^aO,g 2MiTlx\Pk;53I4ݱ^Tc iGƶ|Hr\rA#ҭ-JUW֒: (` |" ?Nի$e5Merw8{ Mb;s m clh4HʍqZFW+ʱ^85y&*45ѯ٘VJ,k+ʥva85Jij83ɞ'g%_0$c=+[,8,I!"#_ RwHGMׂ4QY:c$M\1^]=L:9-mCJh+)`*NI<) ICT Uoq]R/í9k?\{xḐ.is3ǁ8(iO"x+E/mɺqR:-zgbF()h-1@ 1HZ1@ E--RLRP0ģ!;RP)qKQ6R6\Q) Q\oaq#+Z›|ObṱPdeSЊ=Ӂfv#VW*8`9tBW8VE=,}\c,q9b7*==Ų3=Vm͌?};Xbz qRk@O<ݷX,`-xUYOgncSDz]FXidvN:g54Jsq/qQuHgwG 'PPaqR#v,qMһƱK%KsqO@q1X/_1U!fd§Mr1PTC RLiH֐e[+.\jbk c׶X\g :U*?VO pM\K h_[E#\aqm F DnR2) ㊵H +WDl~YElj^+HJKƋz%۵cw¦dcA*HLJ~빸R+NwsV+ϵʘ 9RFGZK,jSFK${en=M`ަq[J-m0Ppy5Ǟwc\tSG%VǜΓ5@8Ð]P/4"<{Jqnp}>j[$CO7MYI5,AlsJV)#ۚłA;vGcVޜE"u`B>/6O[*un+Sޢ[7+;^4;¼/ȭT5ݡ&?9̫yqwru?Z@ W)R=h}猪}K5RSc;j=FZnb[胠lFǟTHT]=)Bi&TIcp̬:pi_k{sRsPT 5Ǫ^dc?~W>1.9*lR: _t<9ZQK1-o isÌS/?\rv^>+(QY6>&ϲF59㙈QP#Ff8UeD\ĵ.mR6;\`eoHZ|C}w?*8Cw@+}on[#VX#c)&8t4JSv=?VPT?_L")&)cN( Z7+n}~ܵs*0>ӭYOڦ[g%rUiMuY\~9J3K$kw/1r+R$WQ 0FA6b%E+:MsL֪]jWiEr9XV'lK22?: k#D7fA6I?!kmA`@1ʊΥƴw dϠ6Z q\`IwȐw HAT3-%a2F;)IQYt7ڰkMRMGIܡ\>[?j<?ZѯpmsB̊3 K Ҝyh?VITfΕnc;0Sӊ(je7R8_#(q(i*?uh̑CP[]\o0OճF >Ym?³洞1t2QEŻ2GnW~@;5:MibXAaT)6rG+MKP6)+J,p3@e tIrs!JS *'1L>)֡yI2?55!9ckq.q\EOY[Cz̩|,8K\Fh!Ei7bݤlz`n½4dy2j*.o*`}jZ*,鹰0/=ysrK>a#XXJoTy1M-*^J}Ŝ6Uh Ǡm5R>VuӪC3/8FuE#g]M6oԊ+0%;hH,w8 )5,[y9FYʝRVk\Y^ *_|Wz99F+c$OꦻRl6@\;ƹr hl:RiHWguG1әUR_s*M*n .z |sId[" v8JB)٥ԇwjkv _!}UPߑX\i1;ִ,H/\5Mđ6=cTb#jIf͓t˘E)ffL8P[8&mU@=s&r*H3~eG+-N< 1aRs\<Lf6* COJҚK+H8Ǧx魷Wo^e{-  :-`446Micqɬm<79dP.?cYGPmYṇ!ֻr0ӷV|[iG4c*cuܠSR3b8w~ۺW3:ѣb>FoZMEf1JWdWcS}MId_tiG'RN)텽gt߼gxLGf9>LC?lktBE~KЅq;3O+5I`iDaoiKqbUڧ;j I K< 42Y!@r:2Ym c R,ѱQʶ1R6i+629g-quߍB4h ؙq޹iKvCRzX񭩜msbn1$dtu+OM\u- :Hq}_ú$lO9'=#_oz@m*pcGA5fzΙr UOZ2v9#YO;Ny#޴y4Ӻ!2!OV]3[:]ʫz}j/"`H! yy?|º hSzOO=>6?I}TgIǭfSb_>o'Q485O3Wb)>k ]Yرr; ·ljʬb*OqUS;ļ|*ԽTTsgx,m6?U7 ˶;U x/CY F]J (2H1d;NFM6ɧY!\2]j4ŧDg[֪jWVICRyrwu7I.TOӡLF&R$8=35uh7{yt֘^=~Yz3|585!E7Ğ!o GᣩMgl[ݰ}?ɼqfb "AOٝY<;)pث}__i>rY?Z۽i%鷦QmYg# }kgYfRb*/H cR'hmp8{zՂX+Yrڱfʯ8=]@VԐP}*/2@z5q/*s4j(i1<6Uy sI+㽣b!;RbRPR?Jv8aD&|C5-dz:&$0UQdgT>&'SNe:j9OT#\Ǩ&'BlGaEP-Dy)$)kpy!@ P;&9lVQڭAvjjVxd7 $ #<'}c<#K9g@>֬ 1{Z4PLWkG^@.?n܇ⓦ=5)Z[$[SIE=2#T i.Ãh_ir0s]Z$4,?lE"; s3 V3|i֩+"^ЦcdAP0;TzgڑIWXL̨xК@UlFY2xd {Q+QO!Aݴ][n:UmCXwe6c*wz ?*InH uX$y@qի$+>wn3;֡y'QIH'tA7F?Z"KAb/(QPg Z<@ĀiXi"B@%\-UcJFd.yMU5 p'a5RX;_dfR+*^'|_wrI*bDUkFgF_`q+r#n&R}Ci%B哩T"$Yl*95f5E~º!-98G&~cHla\R8 NA7!sIRÎ/H~GXi$dR/aQVHNsSj d}|8W#OMrZ\Qnm N1 5у;H.IdfNrVV1)0ҞM@x1'?*Ԙ=4:'j5U,{4Ƹon@cM^FInq׷,KCRAcȫ2j- -CM[4u&H3H5=!˸ѓYRj&KeV2@N U+Qv"TuԳɪ^(78AIF7TY"Yw>=GCqkq~gj۹F-WRJDۄ,cңkwlMĐ{ 8݌}~jt*>Y2M&IZi?\=iտ`?V&ui'UKj{)b`]w]x8fy286HbrIӳ^+{ɃG*ힹ(]rO$;hzi&t1C"9ZX??fޚZM0gW"@aSts5oEVV`]JnQgh4u`1j:MBUv:U`I9Oj)Ej^"\Q_A5$u]r?#jG{߆8^0'?*+VNpM‹ aDž5cN&V9>my~"?H326_۝hNQ;.J]g(%zT#֛9Djzu(Tf08S+aBd\ @+ 5O'Bܒ+ hz'4c:|LgGL9}~RV 99*=>;TP`U(ʮC?餿 PKS{=H QLIڝCߡ5 Pg7ʿSs@Z4su}>0' 3[fh,:Bٛ?[F WH{ s")|k2W2(x55YVz[NO$~cw`)%ZyO"q $DFFUI<ΟTV}V#p-?/zMC]>P窿&9B?j~4~>NER][id}?IGI+3WӓKj5T...-X|.8''3෼L?U?Ҟڹx6㍰Hˈ񃊣&L\E4mϗoʓ[I%IznGzakTћLYIt WiD~e"o4kn?NT3Q #k6~nTU1p۩Us֐حjb3j= #R%XXDBHI:.fom cմHG!xf-ך[M -Dw0sW}.O{Ua9V̑G*'U8&L?*bE")n77 )?XͣXDc AHqTxہyr?쿳EE79HaD袦; WMf|XQLg<)Ghrm&aS5m[PQvcr]QЬx~<)Z;[Bv?SWH-G⹭tH|젽"aT`đ)y'lYOʡfcXx>'oWm5_+ϸ]SOǡMk"pG⡕4$'^`gƭ}2Qlco5]P<34IDܻ[=Th[ź2 ]csMI]1btf:Ta,%Nug&wS̈́plN)^WC4n;M#Y'Q/1zVZf?U-G"Qų&3yi=[ZaB|G||-.sfeg^[8a:CEJV2o:ei4S" U*~;]ex}wzCa/XOS?̕E7aЇKG>^? cX_x߼5i'GV b8´Uq?Q竏֧x?TT#uOҜl?E8/$~5\\k!#l) disF. >-JHf*:HUT[[$4^,Uƨ,,` - GnR}IP[ 'S)֗6B:A i?.sEh諵=)VюKg`E*JG;NMI$Jтwcށ%Յg]M%[ybb}*ʍ7;o^N ߇u@6I"\Z.1#kt&M9(a!'vr+]dmZ=ɱBާFԡS8ɫ걷F)v:fțH*EwlVbGlgVnRf;044ϵcATd)3e&^ XYXk0*apv4sksGM8^~. #Yc}LCd-c~(~4s(;gju\}̋XcP=p ' ߑqcEs=jCl}sĀj9YWEZNESU>àSM7ޏ4Y{bQFH?oA?NE¿ݓP~T) ~,a‚SIeH uMT[ ^;ɮjs" #>Y!} sNeac]|JRVOfh#cx*x Lq횯5˯_RՇ'5c$jAh3%9q^`z$ֵq>u4j}xJo.I! if)8k,ަ s7Pz[9PduDڬ4O]_<-ViGv jVkw:.0PSYmֳWDkܒ1G)c#,T =HzUc\] yNdVᰁ>`2}O5աƽv15 ~*ϔ)8`F$/J5* EHSN _4"ƘJ2 .N3){N֓CGg8!Jc?֍{c1ֆ&q4/5UN " {RP1}F)zm9Ӂag恏VOO 0Ҕ@u zfifʯҘ`Rx~} 'hW8#1njItAM֭3;@|Rݫ9N qX4ڴѮ8#R\,@I@4g8ZA9{4Ay)dQR:>-zjXPE!qWU#ٰMDѥ7foOƬǀk:ٳ [@p>(wE]|YE$ 7Ozϔ4TN`=Qǻ֩LԌnRbDEi;4XbevklrVB㢗讃#›ixrqNcW/+;ܚ>$԰qJ0 '9JSL!Z*s@Xޞ3ޔ0=~SMd=8&s+-Rip(?Z>VO1gңhHbie"OL~4jy)vRQRlni |z+a"O*d^R6c3&(Sl>4rJ\nÞOdSt(582J_ъco%c O^{>Zȉ>Rv2 Or3U){N=v!; 5kXUcIOjWBePUR9o[NU}HdQr+L>*hRD9W堞E (URF2eD2)RMx caQmEL#?2>E2,g^ӱ֙ކ FkZ>#>j @YoqYS.STL߻DKk>S[LlO w>`@fCT;\Uyz֨j'cOZ,LAfjFF FrWq4ﱢ@ D(6Ylb~B=5sEW#ӽJ đqڬH.(OPt/XD⚹JXSNӔ0\Tr84H)m.QzN 1 JX=)=(`}5_i doqixi) šA1zbQJ`H~T֜8@|GI<@- 1v;S|p`{C}hi*2jTi8Hݿ t/?MeB:[S좝9XPfnzcBAVI~JlV]C`1QG+\&H ݋{"b_? [X,˟Wjn Sf\8z"/3}?34}}n1wncϥGvYMɩb$U6/*I>2>$v1:I҄~D0S$iF0 IGy$(>FTՁoqU\. d  r['>X\Kw>fHO {lN@^Ԇ0iCIށM.NZw4JaB( I~8+3I4Vn*iL}Qj-摗 xڶKCF_Dp)wbGc<午#b=&\UOnLð'PM30!KXSIӁF=:RR&(4s0:qK"O7҃)5)r剤M4QGQMzQ`KsNF<QN¸%HiJL\`;ZS$lz'zMISYTmʊzcaJp:~tWGa׭+m0?42)0w"64))q֔$uƉdE5~r>/XObject<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 49 0 R/Group<>/Tabs/S/StructParents 8>> endobj 49 0 obj <> stream xAK1{`wԂ3@须U*> stream JFIF``C    $.' ",#(7),01444'9=82<.342C  2!!22222222222222222222222222222222222222222222222222X" }!1AQa"q2#BR$3br %&'()*456789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz w!1AQaq"2B #3Rbr $4%&'()*56789:CDEFGHIJSTUVWXYZcdefghijstuvwxyz ?DZSk }*q;UʨcI$m69[dڧjP9.Vtt!<ir[V6<aޘ^\p 'wG*:H98TX|" zfCNg0W>^M Ar#{0\E>{@ v4n%iUFf1dnGj!SLq꡺b8C\[ɹdQҝ0=K?*_O(?Ui44<3f9?*0=Z/ܯC%_~qܯ?*0=N?*0=KE&0=N&Pp=Fhzʐ?*u'Zf=G=Rs@GTu(QDghڵc\ ~?2إ1S))'LR1?*O~TNq@ c~TM4ASOM4c~U~3 1Z~>}ڨ,4셁ʀ}W4_RXT,0 U"YDi(sT0CG"PmaSc(_P>TJ aSHI1@ARmf=L+AT"m&LʟhFGFzʤ* !Szʔ)qn8 1&zʐ?*v(L`c1P1?*LAS1@zʚzʟI@~U [#R'^OJ*W< sS$HF%N%U&sj5L␇5a[㿽Uhf8V-B*z~RHInݳU)+8&)4BzAfN-P]g& UBG\M <5,6@I0qրԅwn[pF,fBH?0Wh2u(U~‹I$.TAaﵘr*؁Êa]J9#vCޘ8Ipz}VWȢtfFzR +vsW֠Ie)2p˖1Ir#Nb!UGيB.p҃3+L~V2= 59XlQQD3# pN2 S{-m8RIZL{$gۑLI`V4U,.SCj#ë/Sĥ ^TCjWlƸ xZ#VdRÎh:5 m;)Ԇڐ@ "M0a\ԦE54$6 +JWq<ՏBKn)tYAf +0j!?`| ?lqZI' VAٕ7$aHALKRhe"84RT f(.(iqMQKE7SH|AneLP!(E7MIN0F9bFE1JE4qSSnf^ǽ^đճ]Uo\} /(hCqNɥZ/N3hemE8Jf93Rn:m3ܸ+t |_IjbN)B熠.66H 1\.IT7Q Jȝ #M @:tYN7rPaT̓lH1яj+t%e]9 I+;'vt+H&_+H4.l2pGcQz)%N?[Um$!;:b5WTapR%Μ<2)1&d7I;өE'zSEiE%GF)آ M4iN+LRSHh RQN(KLKEiSOJ_QLGL譞VNм,mJw*#fvFhqW@&ە\bHx8l;cѳV'Mɒryci9r wr?,S R X2p\v-ڀg/(f%*O8냁Ox HOP})e@M?a8icŗU{R P+iH*3S`IeU= ґSҤ =G|A7+M}M`c]\d ֢kў;hVOԇe#aP0E5 Hbj]c8Ri0>j^C' 5 *_xҤP.Wm܃ѨQZ!cR7JR?!SZRLZ}bj%P:P0QH"!@ 4Obi4LGQ:/7  m{m9J_dm+mx̩W$?ZrFSv ԙdBH2fj!/"SH8 Ik :yL+>]g'gQiU$΢9A f@ pAG:b98ai"ɼ`iC[?W,uB\J)474s@SI@Ĥ4)XSM)ڐZC@N=i(KJ)i3ޚE>zP=~Rfo2@\ҦeLyw(Ȩ J=)"z Z6bH=Q33('dKȮrwMr]J.Gz]hO=$A $uaBmE[|n1Ĝ y<_RMK!\U$|Y''_Ogz:ԺE30CM6@&P Iⷹ1l8j#tw4x"c9.lT?l)82^ G2 3&hJΡ?II"NNڪP, wzg+,{? ԗ{+1Nrʣ ;Wn ¦l`܍:129*OLS`Y3jp) %EyǥCHc{~#f_{9sNTa| bf&^֕b1 A$ U@[$#v:9RJ,;]/o=* 16ue;N8TrIHbTbU=5(>d)^3K夅U]Us usOV()#)ş!3<Ne`95Ns"?:uI:OaAҟQ>5RvRvրGjBh< FڟQZ12iL=i鴃:]Ud}+{HM6vzV-BDU TdJH𖠷itr< c)&X|,9K<b}wZH0NF+h2 lHWMqh5_H%[g]mIc_6N: @89M!hi-41 /ZivJ){@ R`'Z(E%%/%OiJ(Evcq)})KmEj#82na ПάYEf L(<&?*InK1fHvA4 PU-a+ޭ}hwL!sHCnmZOFS&őLC yfDROq B{40cnO!qj̈,D6a9ک#N1vPUN2s{ge[֞^5UGjK 㚐"eD0#Җ[ PAWb]ՏewsY-kP I[y#OK'B".e?tvϸf(Ã6=k1Nq`HI_qxG# 0N  YH%Y $*8r ÑUN|O<Ց Su -nXr%z pг(,G "g sE8T$E©c${RqO`Y4ɧ@:o/:pI} { n` }4 y>(撐'zZ(qM=)ԇiO=*2yL=ii1oY!rX :IyV&S Vv1b~ VHU^SavbЧvk2YszT^i%ݲ: ~]G~I]͗}ˌ c̟VűxUƁT` y:"LRJZ(@JqiM4MhCN=i0 (AE~4JJSI@ E-F)M'j%!4Îh=(kE 1UpxGA:=_bfV&K斎mvyT/R{qkiBZ&du:Բ3S9; QsҲ6p:5,#}8##[$en7bWx8~e]J"{hjߘbd)'<Փmkqbmy\Jf?t1*(uQFCR[4˶pLH}zVo|.[Rnv|Ni mg S45̬ j*y:1Ncz wŚL6zP_7fqua2j4%sy|0jFnr(@G.xp(Qp P$PR @htZUEv)ǠSJ_J^QGAHh3!bQ(c@3b/rm dnȥMͲ4ssL',S(xwO3X8(7Itv$/ΧJZW }jdj.*d80WQWZjd-B'҆g\uT pv~h[G-'H[6;3 r3k^+đHd2ԕsVFzܐ.W8a\A-L4ҙu!M2Q%J'wIPj_A'U'袊(=i(4tRPIޗ)(x"?Š `SXml`cR3$ 3fSZϞ뚷$N9ysJ7I3eAԎiע("#wp)\E=@橱;z XYJ,(C)K;K#Xvz,\Q5|)Wc$.%w{TB7{c& \-:[*zW ם\X-uS7*bFOM)˕\֔fs,OF?wˇc޻&?Ed5cP̍K5ѪƒEb$kR6vzIxBUX j5$vv,rj:9PXŽyRs v]p ߀QHbD+q$mb=~5.QZۈ xxcXR36߻>[I5!g!iH*'4(j$cV/F;uy,*=Ev* Q<|qEldxyU6c+:tFz`N#sq pzlEdRo^rz/W١xdvrw}ZAv;xBOzs{.?PV4(OL4/Z[ܤ^=Oa)ئ-ILRuk\>y.2#fBʫwf7a6?(DWF 2:CMn4^ jcӾ++$[bTjͰ+iA OCtǜgO*W2E<o!>a*  \'+ʓtlӺE4$rȊ sҋ+-֌1AVtxmXN!y,39KLd 3Ui;F\ZznMgie??֮µR6*(_pp:sޮ^^uu .Ǡfr` FuU xW\RƎ6#V$z=ϵu uAV$TOBGPAq197T =Y%ڭ$I9ϯ5qYA7:n*J<>3B峂\)TN*YBjm`In =_ʹ/~1էnst}c@{r<+42$8ʺ=χ& Ki nIع3]869=&[]$ qBvֽ8=뗷9YYXQQ3u9EL3dvqvpI.gpc\;`a*/}KkAߍqi%,` ve $9'=+{98"u>+ަMc λ-'lϷzEŸ'rH{SwcIzU+6'UƩ0އ=hBܠƯ"]F"x=k".`E$  p~ur7S@Ѷ6YR GIv@ґnL%6GߏscԊnp0,vw6'hGp36xUL-jRGÿViL^#{Jk=Ay0hҽYddS 91%; Q+<*»OM6o^>o#5,a:z֦@GaZG<5ZZw{|ƽ>0]3wnI~8$~y`[BI9t1͆ fN7d/tN(r$*ݝg< %JF1c#.Rջxո%m(,rGNǑaMud >VQ^}f{F@cEcqʢ s,rrk*meQH@sӟr':FRgf~<_ƺC`u,d DI[3m5,ڳ)ޤ F=WxSr(3hzOzbx J$w,vM)"ƹ8~d$*Q;.}*_]Mh,s"2ܐGlvȥbvr1Ϩ7/mNOcP NU#ֳuSnAtl|zB<s*BJd°V:=A(qg>ӊe˫1&hXt? ZgMj7H8Dޚ,HPLʶ:2d6@AҶ\k5E9\z S[h Yؗ4cޘ ;5"S4Sb@K@ҚmGJ(>vJZ(NS wJ Zf1C֛p:U2)0];Q<ĉm[gUh@iBj٬pfJuk2[ҬCN\@' MFMyLv?b[iG=(Af@##(Ruku8Ӌw5UdJiA"6(LCWu/j嵱xc* {'VCm=@)egZr*ixENRQoԏBvDz@-m/ >b|FylA;16o Y_X[RL輈vcm!dI-#q8w'R~W!TRm)s;^jdd9$<~>Ѻ2kdݖNJ@ަϭhF;ءDZ2 wtzLv {zSg#ټz7EBTָ߈V&FX wOʓҔ#mcin!sWQimI!*sz985]HI1o@+7Ӌ:M?Q +?BkZ/ EН֦4uWV]CzKê3Wm5*2IS1s/CF\a4;U$>T ~DrXɇd9WR.`)4)'ͱAF"teÏ %[W`Pܜg#ަBk!edlkUAp3֯f\oU>١ Ԁ 4QZx4wzZAK@4Jh(;Q[P R))3@ sP7=*Ij1HhORH޳5Xh5HS7[޴I"2" GA^maz=tƀ:I~)"F-FOI71+|I6mŨ+aג -.5FdeBj*sr&y#kSZy+ g ֹ! %!7v~*Z<Ϲr אySf%hc+~qv`=l¸^3ҼoO5X"8V^צj>3,ftʢ%8s9Ԧ,R) YivCjF6(d%JEcŵLQW`x^GZ-aD4Vݰc?YYRzjzj|x>RGn} g؄>|nb& 9S4xj[q?ι]ƶy-j&1JQҫq^Bx)|#w/ksE-*[9i$=YsڽnKMN)Sđ@sn.w7sɨQQ.Srܢ"8 sҒ8vNk~HG>D\cOY7qt$"?1oZRWP9;i> ҶGdh3kR@'AڡC+& o`.zքxRE%9+ĠrͅPXH59T"X^l(oN(+k#%ޱx%x8}IxwӊYmPѰ22:QR s P#VVQҭA 1?1R9q]>a\iiq\$l}j<0OcW'\mgGK+` ;N②dSӊ|`֝20TsBL.vK >vlrh%=P{s˛x619?·DA-Ջ5ʅtsH8{EW$Cکό"7zԾz o_!Uk/2 /}{։,}Ms++6Fcb:UkLfvi>juڙ~Ōmj7f,u܃D]gj݁׹t%ybzŎ[I&+2Xp~\x_ʚGiИrbHұ6mHOz?<<۹O?6m&=HR9;y9d>jiק'Gn I"4lF@"2nⲼE͔gCZIy=d5[}c]A{.q *,{-KOV>kHn㶜nV ^EPT QWSINIjqA4GY &c\OĽz;Y۬1yտN?X08􇂧>q]1Z;lE+Mg lƆu2EӤR4;,GZƊ_N1Ijˁ4Yy+u]J/h74HN=^G۩kR.X `dx#) *Mvݞثri#եUDTʽ3QU+aPw׹jIٛ!M+1fQ5i bHgn0 &U;F73D I<OClkJ a*6(+?/S'mƵTԪk7RFLKY[\?\YoEq"N=xDK[啔jB%7+`aW}kV Pg T{_ EkQ py9#Ws@"Ddґ5xռCJ;Jj`-%1nⴥt"oSWb{GKyi:?Ƿ\n:s^R,fTq6aѱ^qsA \TZ-z~vuNѮ4,b̠ U$ @=+U⻟xLyr ǩ(ndS$y5_b͐: h:yDbyXئ~WTM[E9 `T"ެmonya8}YqԞJi$Bۈunm'8l{kқt9- 8c$ :_zhⶲ9ef/&G'bPuU-o?ᶉ#6ڸa HR0߇Lͺ9 үHAj/V#l#< o9ޕ6Ox$k(}1Tm>B*@Ȯw֚I˔tΔiDrz\8(2#VTvEw>jzEޑI{՛#oQzjoIct;N.?{ )6Tp=2zHַáچgI]B:~DZұu&0 @EKsk%99eXtaPfWQo@ݾ+˓qw$pjvO+>zVZ\o[/tѯYo -J|zy{yZ 2\kSkwu7`u_5/Y]А$7tS%H\z4?ţV:y2N;X{T [Lڙ,r9~ 3H29R r/kSEnZxdG~xkJRHi{/]]*80~KJd"ܰ\ߎ|uo䱕6hvn'ka=~&i餷>|Pyw`6( <7\N敋4!^)pmG&$rm+k~_%:#{)=+|7qV[Fg+_?ÖIkaw G@=_'1'k#_6@fӵdվfWZa !Ԥc&ѕ[`5aϴW&%ΟovNFzT&TJ']ir|,T?ghqkx[w+MK<0?xҾ]LOٯ1 ה-3tWiGO/ kٯݴ}"_hă袟n~[#zh ߼ўF+c|٫qZ#L(Tӌ[ETYs;I-(ABH+0TxJOSrՒ wzh4D{RQA(~POp8I:RLiQ͎E/1!SL|~T"Li%??AךrMrftUBھumn0Qq]@Ѵx<v= yށ3[xɎWXInMogaSڷwȆ9\%R vvy-ԭ43'Ly3JYMJ;UM9iwc&&Qsy\U99;s5,IO&vڮP9$/:kƒ3_GʱnRyU6.OGOO~elf"8^ߠEX NYr}ƾ[/畳rS Dv5@JsFx#Ҟ@=*o#!2>f(-ߌ&g\ii.Z%PB29OE4ՐoCƚeL H8\~e̺cy9>/':`ho4)?Oe^˦JymwG"@H)+#5p'2VK庶*9gHUCzҳ7P2շ"?xtgo?-u"/ʼ !c=`8VB?ZJZŮR0NUοݭc=k;]'BFIPG^ /v3|иpP?:C4M5m& b\pEHXHr2+.L-Ɠ0vWEQ t \JbhPM Hzj3vj$O92ߵ@+"VAc+"8?rO=p:A@z#qZGvsFv˟{%osyᐎ7_=:.tEyæ1{ܴ>lf\m92I[[f?$Vc+㹵Ed-h^+Ha{_.9ctЏ=h4WO^ͣxc`|Ge$W7 M4 ]7-9;A̶I= otbZ oڡzb?㿚Y g9?`՜nƑJrUc?R^sT!e524Ri$ =c=}CwſH?,:{Ʒ6Y6xڙ2c|~u-42 #r=MdA4Ҭq޽a9Qw=T93+:]$q|ߨe3z5j;4%NL*529LTji)PzH?J(=Ҋb:AgҎ*Jd//Z1@4 iRtԦ6k^*xexj-b!$?u=E=0˕Z?S=MLwHDǐƶmv&6k'{\`dAIhZ6,Ddk-~v-SuƏuf<9 ש[{ .@>K$qXn^=ɶ1x HH*TR34XU:}k:o1R닕'hPpkre'ڣ3F90oE/Ჹ]Mqcżjdu3!Dxz֨jF'a" f%|^TBWeT2V$x{p5)j?42 Ӆ0 (;Pa˛K=\ϗ߽c-YUA8uƹ]o,pA!vGa^CijJnAIkvuឥjͼr6I#.y-}*er!4L\L/LAO\iݿxW&is+h^+FrL#eu+QnQGM皏+nPЯn,W0 uA@ })gQ=O5,jdA 3JXղč9bC"@rO<]XsX~)Y4s<!E v:?wa43] 0/7\FזEC<0cWJ`;vYԣ0X&1<Ժ2#F2544184)PV'c|ڠ|Yp.BeGSIƓn?f--U$< 3d4kzʰ WⲃT;{Ui8b W#)ӲXbL~k+wvAI`0B9ʺ[VcsbK<(REB̀w9ZBBd*\v[4sSj4|(7|^𧵴_} BF gKywt姺V<I=ʌ(GχVa"]޵E>lۣ/pdcVxqLQՄ {җ"Zr{bY:4-V,_2aVv㹅Jt^MgHmMb}8X׈o6EFP߼ .Z۝unDḨ"G aoTfhs);tI)~C:#I63(Si7QVI&+GBӵKgM  ӯpk/u(945qӹnx^6їts4SE'z۸}+ޟx~:M^Y]4W8 PGc]mev;J)'NKSj H;yףo$[I!cu{+_NhW204 rEާ꺕$$ [9b?3UeUR 宭F7":ɴ8:Ɯ}H cđH`gBE`>@\9Rf\) șE1~'!#*B|zd`V֛i_9|L3{X1>PcEIY ;RKe%J~+FMlC[ rַ5B N>gOT%)?[m74FMb?/Gmw_]?݁qzJUo›Q}Y*Io?k 7U\xI $Wu[-H7fê0¼cC`:Z01Oz (L -tV{wd=PSt&5WE5}n26؏"\ + )qͮu:U z'/c4sk#6w3csr}:}!imHs5y4؇VPNM`=YȫmTy3)$ZҵպVkb=+WZU#.If ā3eLdhd_6>'z!=9јp[pptdLwX[+J _ǤI~ĚDzj=LּSm Tv'ukkQH:"Q]6cɽx3B9?J³_Z#Gw91FxyQi͆.wk4!5AƠC_ ]}Io[/(`k̗Jo̼,s}?Ý3Q d[;؁g-]Fg"]+W9u+=h4xUݥō[B̽U=EW8aѭM``]ͽRFk 4GñƻhWUUoȬNF=)X0\ӎcj37~쏭t gڡZ&R0:~(P6l@L(;cx#R&4USinQZg?x܎[NA?:SSS,$Yx4휫~u`UP☶W?:Rӡ Ԝǻ,B]Q#|I[?e6]k>a!q'qް XmZ2(ȗNQԾIe9UۓQ[[U<a#ַ#:g*GoXTtU=e_PiE.͘95XtOA-d\&r8ѼLRD*V"2ّ(J? pJRPp vjojR V.|7 .In8c^;FMZ:G{ Ѕ|J9nzT %x<)"Ns'֭:҄rB!:WgA8ѶZ^c<.beN3HĿݥ5 ~ha:#:weq$h#VE` QT_/[]j gnܜY`ZSeRP<" rFų }?tVN,@_ʴ2cżAi-Fu]W,QU=+_J!@˵;T4 JSC 9-N[_?J Ldb+?h{{%k\󇶝 fctC^ѡ1$*wؕ_p kpv&?kis.xSL/WN-+~a#\{K!-:;2&F]νZґus_NHn4!cg 3qgZԒGk|04D# 6EE[ n `Jw Q[N|B[t[c?xZ)Dmh1Tn-Ah]l֤ePqiÍ9ҌsI)+3Rʃ u⻥vp t~`Li,g|INrG<)#wq2׭]ӕXUN+GI nwBOl{l3X̤\~^ݵ1 W*NЄG#pՙ{ˏoS㞎`gJ-b-q\pJ HIl MEFhꀣR29jgh$DcQ$ʌ?P±:.ީUĵ?N 1rjNjTYXS'hGR MTS}67%gKu"db18f8t'cj3es֤Z"N2է4Umbk$4&A 1:<* D㌒zWOC n+! ĤSL[=)w.khPViXGQ4g94p̀yhnU'֩:ySyd*_vG^9I9px)ǧ|RHHOJ<0zWw==o)ĺ1'0^cnjO\׵q}Qz;c S8VUF} jWa-F%TT-U;*ykҬC=jyTU@kE#)EO `zW}+=Cè6+0 <|JFGǽ4;}='#0.9 9,2ecaqyƫnl10 N:z9œ;Uw R؝yk"ZmkTgk H?T#>LfC ;3HYݝXkE+jK뫌+U? rjV g3ji&8\ +#cJ]'4+!)Wm ]Gΐ J>E?QBbss(psCPgssZ㻊d{L[i=K~d/MTv7΋l߁,C:9-|WܒƲ_Q/` 9V$^TVPz̀B?|Y=ͧEuk $qzl#XZZ9\8"9SHFs{/#Y a?J$SQHOLҶ 5]%e<5#p[ra_gt0 C'>տe#xUf;Ȩ8_g7V1U$l-VQZY/ H?^D G(~5麱d%QaAd?dSye]Ob+ۆW02@JDV܌}7WZU)Jg}AE o t85IKd\4J:2T5/va0@m|p^^DaC !$5ۺd`8 ##6ynfii%rYَI&}C.nz|KsM֞BB[8*F[C"`5gO}39rM2Rؚ%+Cj!hEۀ>1\gkǑ Uv{-o54h֫q'߇Oֺ<`#~&lW^z\fOY\hcZbܡ<CYRO+nF?*\QiqEKIƧY$OG/pj˃Mզc?MJ8QZ)7sca'""] 6}K ':jq$0[3It3&Z3̹)56AjWZG躭2fxNjra}eOUn%'đrGN v2h`zU5cΓR `$QcF|FZsФ$t&,#⧞#G ^ jE:ɸM Ϲ=@>ՕhshSR=L\S+*9 9ԌjK s"ecuԾ]Xgn?TgMZfz6>9T3n \iJ;zrDc2954p==K40-?s z43ʬtz,kU}Kb5/)0lg^c[Qvo4ħOꬕ,SSgciGfæO-u}~sqpsW2jx\MqJەRJC I\!CQ LQ5{^ )LSIPOLu5-O*anEIq:Pp{⵱qL]08"=cz@yL;Rڥ{1@ Wn??xm !^'Ց$9`vb|K7EVa Iif..2Ι݉z)XQ[WjNck!{Ssϩ,,g#b\WL]%fMr߿e gs3f?zƷ')<h#?5GgsjjXydjW\GTJ,P+5wV'_AUMR*+Y rLC @%Xi'Yմ&l|xgtR"5s[Ȼy:eN@ՎI^<]%Σ\WN+XmcҦ򯶜vGsWtqNklV S8U94exk_$ܱVg%'4NԦdpqӎ*(nT8TZFr eV1F+sI[06lM[Q لU C|æjЦxd1ΤQLm|ަ2@@wVŭ+7O5`YYdL\ާd.CF7YhnWb;& !P y}9]EXZʠD! Un|7gEmOɍ $jcU(CwHy (?k:Y$v EoB, $cbeoueSȧMnvm1‘J"BpLȋN?4*v(1OKxE_*QG`*7b?Zvw-?:9r#?<>< Fjs+ Q9ÑfPı:SBu8SQ6#V Ipv;/sTD̡Ff⛱Eޥ @#l›?ѭwK&s%kɂ:1$V&!D!Tw'U)"0̢b HN-VZUMDa h%jyEThNEPkA[ ֡$Hu'ۊ`馭sm]3 .:]i?¡xd1sژ: pJ^qFSdLjM؜@,~Q՘.pYNqIME(ŠRvGzx QҗM(B]zb\IJvsQQJXrl?oi3h3@KEf*8jlRdl0xj HRqE)Ɵ_u0f>d_w/eK*C=bj R:Ĩ,aUkrW%_pzݵ,q\ks]>o0G_z6µWUJ9*M>}d ݀xQ]:i}6Df]~Vk1&mv}: P*d31;y=mt۴xF`u+REPkjS9A?MW" !]j΍\]вx:x^?9^RpO:KO9*W խKÐ̠؃Z)<2UCR_O?Zu-.w^9 ۅڧ ZѿE@@?\FgrBjx +)Z{v_WM|~]d9AR{W W3GD?67,bik)V6}bQ(F܃qUnuⴄE }sל~U™-㘔reBr AV0xʱjn5Pև~Gt֛"Hr^-At-$RCсȩT9?J%ҚS69oVFV?Z4AO[KCz_~OkzR+#K([Tmib?aAבAuԘXf=ErPԁZg fMCT<TU%̹)c(?GJz؏Ji(c_V FNZFc9N(Kyfl"B`\:95#_M7=T1cnG-QBO;KrOvbO⣝)S]u#DUqL=?g6aH8X|u8 /<#941zӔ`sEԣsAAg sR'ۥ"W*:R}ZvQ֬PRfrMUUph4b & NysLRqE1CڌRm=wN +Ipqh4sVz#7"4ԥ= D}1N#yR*LpI$c;j9h33n=(I\A'NBJjHJxT+kQ\wSg&O\y7 `)9YtX</m4rr1ڶ7tjJ-euHy3[DLW@lvy#@/n*+œ#3L,Cj L[bHwgr?*t_)Co6JɶYkUP0kҭ`{qsm!o1y W#k1l#І\[ɲùyYԃfj(;zTON lr=% ~5<58'?i$FZN9|?xR5!Ѧ!E T}ҁ,9Ryk'wXjOB)ۏu.[i<IZ I_'ﳃѿZ CJFt)6qjPeQ@1 Iؤcځm\X$RpVCʜ}( u_ǻ~9|z )Y))E<1t c_WL[1ԩo$+ O?z~L:H [DZ@h"P}L[p]=b@,k G.kh[Co??ʳigv2>>ΈV~5W\Iuuy#_NG4\ i Yfc|}⥏9*C?ETH94OʴZF)jL'QLDr7Қ~1gޣ `1Tx8v EH1SڭYI.W9&̚vwN@ vT8>DTlTi mp\cȦO21V@=+r.IzTmqZF6yP!SQfA-AO3 5Ei_̸>XR$g iƥ)rs3Ę*O3PPp3,>ݸ$UK^r\:$Tuw*MuUn8r*+qrx/mƓiwcN ځñU-Bdnاxa2´g29=* Hh&VzToz"}A<$s(a&i;S2"|g(."A$cL`èHc=q3uΗ5Eo'r1n;T9P,)횖$D#R{@~?`AsJ’nᦄGu|0qҫ8 Jlt4yE>De#LuJqND~_“`cF 7Ҵ!D;Ҩ2'OƯ n*Ы(=ܛ ǰ4h zR;LRjbҴy4}i$qLWfsړ# zsL=zGa`09E4+*;S֘dK\`?tyL;ќc֞$?Zb2P㑑VՃuG (maӊva}(*u8?Mp6:J" ?N҅QP%@a{E-~t/qQ7qP48J,-NGXW8敃h.8[*A:PcF)';[):#W)ěG֙ޔIUIc*:kHCJ/sZ[CorjBs93+IE dqy> endobj 58 0 obj <> stream xYnFe^ :탪_ @ R ;E2EX0y oi'0x/ntyrW\<9DqO t!gd= - -w>V Gu@<F:p#Jbv9  ŧ?\<#r||Ws@ Yb؂c\7AoT|4mq'-eW3Kr@3y/#%Gg>\<`ٞXS링IM 2s-db\Dm<`v6T60m̕Mvy~~/י]) f]H1X5T4SqA*3b]*by.%/x-U_[mm6h_:4H;0&})WOkK>> stream xeRn0> !H$}iOU/)R1Ȑ_{76dⵋd73E fvR(jI{Lt|Fmzl_J~՗Ӭp~VT'l^5ޟz3s,cZmXOuưu%}7/ksS-#01bA4 ZJ2,ޣC{{ZNLJ>]'D': 9!fxVF)O ȩ ;B!?ۣ8DYڧX7DFDNɄL%r$zP('-%+ vuxbQjݧy23YyhNJQ0IN8&t> endstream endobj 96 0 obj <> stream x{ xTյg9d8$2yMd"<`!@Tޒ^ꡭ J-E[>j{Zj_LH{ok6Yk^{흀0B H [c "d1߫Aޓ14a[wo!yIs}ǹʋ,mFh5/yO1^@hmBiS?{!] !ؼ[\BA!fuy#{3B!]ת0NϮZes;UgYP7/A t@.( ^a~ !׺Wl62Adxu8[@ BۯqN}:?kYe)BԂ\۸it6XZl2V3ݵP>ҪM'~52~is4VHOyOo@*{ˉvRc| u0Cnm=2OB+uϓR{%*ǿi:%yÿ741Ak軟C8Ni:M?G!?MB>cDOC*X+zH6IȍWGɜi&Yӄ;>{Эh/|a_B_F;НRat7|G=8tݤ?atE>÷q@TzP)@!Ԍvԍ d mF[у Wx&X.}lLo *GQ] @h'c$DBc?L>&cN=v۹WϽ:ne%-[wqsܶ9-MlnVmMu,P:_\(\HwmVdd izVV)ra0ahi\#7DEYN??/"?Rl%ʽ"2cH &Ef\(s??&txUx} =.Sd U3l;]UD=YDTSHJL@h6a.!,"1{SDV|QXFXI!-Yy)hUWAcl [ E/|B.n1 +1&>sLiVh$:EK 0ĺcXW k> g6RX# 71_9>v*R9s"`BT4jQ~,Zb|IH1D܍]bf[b TA;,!#IA\.r(;;ze-w~ ~/1JkNjݴfgf{9~}Oa#o~I덉'`DUURd9IhNWV+ڽRG*,ϽW7tF8C/AQ_EVĵ"Q:*wbqCIKaڠ FOWޒ^Dӕh1'"Q,NBO;Cp UEÒK8' ig'D;֊|wr 2X vKWORJU䎢sҥLb (6K, 5^J"oT0TW5z&ojDXlRݚ͹# m|='Xۺz`!˃BDe(iԆa0*NV&q$*Eh8)4Y&HDT(F-a`|f:QïZ>D^+(]ɇasptGy{G Ssa1gD{ 8X7ρv@nwS>["j|@h*aurh$tc,as쌈/g5 jE'1C'GM|t(ܢƽ~u E,RP5@24Q?gNugg%vVRJym1 ?H$Tڛls8LeHZ)/XM@8:aRP-ݭp@Ra,DcJPt:):>6oqMHE>Nj 1"S b/8NT^"WJ?Dq5*L1* > *=n -).mp[%B{P=>v#O-yP:<SZP$/܈yf|@7lsts?]]}y;6dlb\ՀV Z+Hhڐ| `b80^wyB :3kq٣+s_2-#Ì=\/~kE8$z-ŋɯ, Ȼ`ػmܻ}(7=ػ`hܻYiuTXVSJVEzsΆ:'? `(Ƽbiz?䃒 Лr<ސ Qhu JGdrŒNAb9ZCѢ&+՛^7Z%ZC QGHz3dݫ(v\dp,CvIfN.X<v SW[f:kZSV]%=ЅESj f ߅!1m;NN&{{aPE68DmpvkqoqNWm=_xYba;"b)ܑCt!ԴqSs$FB~>Ѕƨޘ-l}b=|xҀx&HA?7TiNtީSӅwMM=3Ph1qcc E @=p6,L; `04j@ >}m[s7b^=qةӱ'bbdžcbĆbcbvvĶǶ:bXK2AzɇQBn"TzLoH)!p-F9p1BLx=-LPZnD0MxaADߎzL\[%b0;BG4gd'r Q76pv7#CI}7mg|ڐ,'WDMߛҊǰ ©[BLʱ)--NgY Tf[IYYHu2C[P0HQQ[isro)UzJtA0r$!csLecƍW(Ǟ|6abR=;xq̗kV+Ut$n6i ⷺ6S؇_ |MjvB!)&zqxٜjV(+!sϑr{5c4JցL'Y$΃RfC #OzRvj5%Dmg0 fM:0v{/yxچw~=sH_?ÝO?|>#ۓkwP̴(-E-DRyy]?~bLq] ?*?}NhB_tN/\:{.yǛ~nQls0x&χJM|<=Vo^=xSCw\gȢMJ&SH<''H8}wP0DZђ펩ZM4]};2lhI#|n1ZoH%/=x^MQе/FZ~FEe)_6gellq[M!ԋ<)憣2{i.]kii硃cc +V`<BPS?=a'7a-/zHrz8=I`pf"]fp`eYrb:<- ]ˬbVfXwXXN#-G~Xd2/ȸ@\e=*p:gH>e[KH`mYİ5MĝOM)/s'LV(QO&Ƌ8ޫ q0T\Pb٢[ w얷ԯk=/+fpe;vķZx^¯͞Y ;v| 6$jwj<"hY$e2+ I:܄dw$ɍ#.ɡtyteuy_+Nj lUpE?&{z]UJհ|_?n* g#[Hވ`a*:PG Z'^x zJm'hYMmdj;4GTT+^{DO+%'+'&L2a2_uW+̞Rlegw]hQm*tjw~tl!"ں9?z R XD:0gUsf`1/0e6b6kAât%؈@l4˙#KфPPX}/8ͤu#Bћ%V%vr峻ywz-<2L(eA/բIiT( @^|>8G|KJJ\ NeFs4,eAgrIľRz jE,|`V8_dǧ,O]l%EV^F#XuH:fq{d܁IfxW?GW17wu N+'mS>ozū>~4-ok 61S2Vh؊XT(FCz}#iM)SJ0?q헯??a)jiʼR 8 H4ɝB qFP8L@ѫZ4`ϘY*Hok;n3e|CUUUٽ8Ԟ~" I!I!_p֤ >uTGo2&3hJF?;gyغpGjAI*(W{2|EY)gywʮ4drڍ{NzY +mEfEZaiPz/ ]Sm4\Jt$&~cF~m߱p7n^*lYls]گ~'87<{FuQݺrP䬭T~{$~2]I{գa`:b07 !Sб-dB֒$nifOkir ;3GM雺#Ge겺K>Ę;6 .[RwoƶYo4p[|M}`Bd,UW f$Y *ϖaW*FNFX=]jLRQ}LI?g+Ƴ+dqsxT%Z-r6sΝNQ aMz`0˰`]دA@seNtaL1TQ啟T3M~񓞚a{!M>]U;û OO3E~qOjѰ# ӆd2bNz}Y쳟kmV>zqQ$k3KWLeeI%x9ͨ)|掿k,=ܣH5ߠ*J(bő{o95iLC _W9f]sib;uZ,h{۟{AAix-CbB7>E{wּ飮k pkgF埄}ǽ{*=sWnXEy C JP-]72X2|@l˿ݧeW7oޱ Q4_:=?=8aaި05I7\>Ĩ>ulܭ _C99UGIIMHQf FzUeiYOkc o FP3EM9]Ή!/_n \#)-_඾q՜-{aӋ#?i'#˞|򥧯Jj/=}W}שcfƱFU5ܨ!F:vΟ6hm_4+fT_RA.˿ re 6%EdžgulĀ{,i]t*/.+t&8{̿,3&̻k{Uvl4EzvSez)+,|BŜGf"j^Rُ&SdպG62*`<(T6|<"xaB5UL]2s[NgM5  c~)(mVmH0HV֕NM7] W5vbH9g~7ȴC4A]'Pח7s'Xo?\ubwޝ2T&{R5q덥+ ~3aԿ/fqwUܺa c)vIJU|Y5XxL2{>}N~%L..3$)7S5IrA?|(i#.F/ɳi\>\ rA. \ rA. \ C`LAڤdL˪#HQj_E>ʯO!PM>*F,n^"ېog*DqS3hs鑟?m (w!])nCtkĽH7Pn&o_C,DMlEjߦ^ >{~4if,YTC:m^e|07!5_ DJ1` (]#DHwS牃cnEZ\ h. գ\_ϴt(ݍ4* &ev68a(]S,Kg4K#HqaF(]Es(-"O+ZO6hh 4F*H%dJM(ic ?@hŒ<]El.(]O&SZV9{#|4B*JP&)oƌ P5`Ҍ;t=v+,یqxHϲK6OdddddIK!=UʉH?8^1I"YOw*Ur^`eW0!F&r;ذZΫQkoZḜױ+s弞M7!>m.M,+Y| 'Cr^T'ƳS*fJ_Ϋy K弖=:6$M9g?HSyre|.#2m7\faVK[A/OWe=KyIR^ҳ,%=KyIR^ҳ,%=KyIR^ҳ,%=Ky [5#|v҂)\dK'xeecQ Z=wb6tcK+SeRD+:/_cc)kA1ƕJyDG] H][?1o&=P>eE,b%-+4@ ,UIj">xPRW-]@'j*>+H{Nқ>K(0H {)D}rL>yoIʈV)iv^|)ՔwQ{j7ZyY_rୂqO qUThOx]+0? #Z'!^Qޞf7iH^er -;Mv+k;%-IgaNtPdI̱/|J~<%> ٹ:wOGyrƵ$HqG1 {&2ӖtH1c\"/ˢ>I!g ʧ}60QB<Կ,+eBNqJdh]5^]75dFIɭr]&PiO_4K~~pS q˶7bTvnYד_xNp7٢/B$HnOF쫒"vSlɞ䎟Pn!6lQўMɹ6&_ Cnwmc.) ms]AWw(JA[9]Aw6wl^-y|%i*E?&^ @UA7%>C5hr;pQjwȽ몒 AIn~Xո~749wC8k]?QkLrڹ1=| vXbCg{|+}7nxl`/>?ן/]pu$sU*k&fuZnpU\_߃)JAZ'\u7\$~ ʉ APAE2VV)SV+'sդ+uO+AUa8^ u>5 [u׃k'' pV1\/,pzӓMM~/]GV%E:kAsljCᾣ3L\V2ȉ[ZC?SfzٍGZNkVj d[u-զP ju{AƽIdF8~~X"AU0cC".ud7h"jҔS=~?o6T&`i 0z'>^Qeen3%ghzbm6w6mo~f3Arn>2*fs8i-gfUq3|mK{p xf`"߻֚SkHX{5<^ڶh5=-:kJTRˏNBaD\s].6v&Q0⾛cԢ5QRmz1dPp6!")T31 [0cNEDm텐;lY0h0,!/R2?_ѯ$ff#zv&GF?DڙW[ .%\r s;kyo۶'=x֏D.ynsz8mQH5K^S$4zAo:_;˪zn<'W}DMdڰdJ8(.U1!J0d zYx fF?B5ݬffX_zt'uFAV KUAi_og5?ߞ ӽ5S%,t,(oN쬽d}+~4q Oϗ-(g7%GWۺmx?pלZ6cV fM܆ PE j`=+#(&6oaK90,B,zDK-Hᨎ$wk1T. %*Kz̀W'Qk 豇l:jN{"ME 3)%5^zS((;g7vDjjxir1 X`9Ɔ,q,Liҵn>*g/Pzɔ)}ʖ-Q((5QA+(Ҙ^/gm>+Bta3sLJn~Z"4Lpa'\!>\jIJ_mI_FrGG%?ŒZ\l?j_EZ'^H'LLe3vãtS15^5}f6?`j6W>As6[)hwlDLd)#/Bs .[s15x=#q0pƱCdש&jڊv7Vk{(/ c9F'ӇB̋Իor %f kmt89.I(.YWd:˶d[GfggO͞|)PݒݚݖYvh肬S DߘXi2A>L\hƘrf'I d[CZ8d2;~\H=rss'Ojey&:}-ncc9n33O2|‚ :g>3;G7-TQX7@u oAީ;Vղ_v?]^V̰‘psgpг\pvk}B}k]4ЎDI"wFA+nW"{\]!FBQ5Ώ&ĹdYa 0Jj%c'G2^x.[UUډ6& H.í$DnisG:yd6۶gz5A#ܺi,k RDomh'|*{њꄸZx:$5[[ue+uT#$tIS%7NRHN6=CZI(o.? [)^]7)yt݋3D3Ϗ jGJ&=-RD ҟ I2@eSb'Y=E:S܇cϱu1'݂ȱfҒ,8,mRXބP~D<3qn,Wو3g;?'$ =+EO-o'"$8#W׽#S:O#Y[ : J8tIEC}$8q^K7X 30Vӆ 񸸡[*8q_66on2rKӖ[6Meom"v)br{a>kaZ[QGHAŲ;_$Rpz1Sh!ObԓifFfێy=qaX,[0Ƌc e* ;\@xQ0. zۊLWԊv{*$j:̞kE֤ѕDc$ʹ`̑ٶfN%iyzHwy35]vg=jngN*nÏgw`E0Z<uWc8`p E8P ,`~PxʁB@UU@5PKZqxГx߀ooD%v__m %PD@< =2'Tf@0 陼4Eup3[Svmb<n>pxB}څbKR ,(@+l61^)w<o~'~=>p8G8ǀ'?آ6[&f+[iy[ 'I]$25 )@* Pq/ ޼| bqclHe(  x9ؕWyp5p p-0&S|`*0  nf;N`.p0(@ (JR `cuauauauauauauauauaua:t;vP3vP3vP3vP3{zll9ֿH#&؀KˀˁQ@ g W.k0>*? W_.k -Ocwvawvawvawvawvawvawvj؝؝ͪ[TӁ[ۀLv`0!qs,O|ݼW gUÞ{bgwag7ԋP ac5lvkհ1v~v~v~v~v~z <@XGPT8B}-0u26T JV#x\֢:7W Rt@Ng]^v/?^^~  xW`/s` (&h 8 ~~xx8 nk/^D^]^]^]^]^]^{"zA:>)6?>=:?c g}̥<#Q5 @8K ^sgQ|M}5CS'Q0r! g@O-3P_<a^gB`^e0,|@ 0e@=, 1squO͙I"XTn JVR-PFip .XXQ,MWb :Sa@Ki)b}۟;ss}ϙ~k oZ<]Q\#ONTyώnDӋiEoNĩwp~/~1?¿{ciAc~ /Ds_oT>Tfv:g)no݈o[ЋFw5̋Ze*ߏRԟ1vs}QfèaaaajaTJQ 6*F%ب,6KQ Yz:G^ $٨$,F{32ьLL֦ov_7*50zچyLU*b)vq*Fϼw׊(=V1w\<2V׌>O_.6+l]$ctK2KIG/%}ozm|{>h5CA X GE$ +Z [jGkzjx:ڶ-8 {c싉ap04PLŇp8a:aK؂SQQ ]«a{>s[E'y=>?ύ}n|sb8ygl̷|\O3PsjXq.hǕ Wz,,*ul~ W-u4©^j͉!ZN÷ Xaʚߒ W~1K[=;wzs?ۢ#gg*<~3ſ_1dH$CL]t_kzaţx̶'(u#S(i_Jo7U*`l}#lR6n[\)͊)׆Pvɸ޶Peۮ^=)o6fb?hFh2n*7u͎MV&lUɓ*+ϰL|¶cp, ړpS,O~yhA+>klq.%H]WW*\kw:,B'wXXM%܆|+|Yq ɸ#q]'r>_woM&ciS9E9q?_(q +æUb!yqrwߌ[K+u>k saAO0S ?~k^CdtI64|yo87  y::G{fl8+!>]KTwI|NAC>ćqb}]o\R\jKru,\LʤX&2) SR\R,T~yjq 1K\R,bUcjLT@|c]Z.u~h;p-:,B'7v1`)vnM][rV_ :p;2x\Kr)K\JR"ȥD.ʥV*2)ˤofkC. `'˦LjILJQ,byˣX(G,eQ,bYˢXŲ(E,JdQ"bYˢX%Ty*ZQ,byˣX(GYyGYyG(Gg sa+j؊a a2lVʰY6+ϚgʰY6 +vEn='z."*ZuTU:Vʓ<訣:j(Sx(տ7' 9O*KΨ <86/*}<-qU׿EzL Z3nSЂqTu{?gЊ3xh+ (3ˏ_>oƶ<5WTFhwyqkF^sY\85esY\85esYsտ܍D5qf?׳Ip04PiA`ylVls_N?pN)8qNxφ\<};p_ڹwᾧ}v55鰱h.x7v{;ދ=~|'Є1 s>8  =>$NN8s4IÙ8 gD>-0bX#8^c|֘е^dŸ|.N}'<դNkrǓޯݓ+}h_O9q$LA8`*:;%Hp/uXNs=c :M1޲a W<{3fмBVh [y+4oм:dkKqsEXl,2P7}cp@x$uvjhJM +yyQsjAx uڅ RK+5ϼ.j .aո/Gǽ`5lf-{}8>pN)8qN+qT8_{R՞֞ss ã2\jk6}kݡ>wk:c1@E< +keamaj!Zs"Gs<7sE[sfg&;c'RTJ}RO*I>':Rؿر.Akc!BY)BY)B#RhD T}`9 p> gq>.x}\q>.xr,r\9q8qp>Nlj8q'}xq,'9Nljnnn3uGnu#\wpݑZjC\-պZKzZWj}UW+r"W[ՆZWj-\j%VWr.\J\eZW[:ZZpnj]\j\mZus.:Z#WsW+qղ\5r>mgʵєغ⨩mI]};j5-4:zkh}7zlE\{V_uk]izf]ڞ1ERR:Qԑ;)HQ3(jDQſQԑ;)?(jQTI&AQMU;*E?(jbUQUEME5Q jQT&)5(HQvRTN*(jE5QT(7jDQMTQ 쐓ٱ}Mn=Hҹӳ@NjfYIˬIˬ,KNiYI)9)f)YRq阓+ct\QMJ*HŬTI,54KJHì4I,%4Kò4씆JJ씂Y)9)f)XR~/+r/[M~K\5zފjUn@e]Ne"k鑨/U^Z9'ͲfK=.rRlb+p׀JʚfUSGjV%UIlZqjNJ- S.T193=LO53Sn5j.5TQCl?T? O%PBfSTJI MFs)"("OmLs)22vB e̤|| iYҐ~`܁1 8?S7?Tq&S}W?SLR?(r|gmg̙1cwA9s3;ƉVhW?QP%LA{PPR\ Q?(Jj=(zO6j)jjP;=vʪ:kiZ(l&Qذ)nꢴՔ6Di-6SZnnOqQ,k[;uS򎣼Y5ݪe}Q%{;)a ܃{M6JJl=)n#km7UmwHQLM]T RKZʔR!]T2H%(QFQP2%yF//.>h f|x ,Ͳ,.8hJfd64[EU6Se3evJfhv6Xe/)Nb}KK٘.q1~;v1w5=V# wtsjosǏK]j3aZqw490#mf8;g}Z߃fNP3Kmw+3n:Ĭݬk{jnbYmws=hFhA3n;,ݬn~3h}WfN|K[vi[Zwno}"m}wPE U4ZSF{[j*RI$TRMʷ> d)iZ߃  R`٨Z(h}=HI4h}wQS;5X9{)Z(k6ef}A{:N(v~^MuY릺Zˠ=HY 춾;-_n w|2;RW/KjV| cRg=d;5ΥvJ!JSN-N8DC(q.%RbB8DCA(RdJĤJ6J\F)q%A8DCA(RdJ!JJ\Fm8'Sb/%&!J>Q\JWԗQ\JlĹ %R%U{)RLJSb7%O8P}R6JE3OC8T}R6JK3p ƾR |wcW~ utؾ_g"tRX,eH~7氌:(R'6ʛKy)/OyC7T}"_Mym776RИDI/SưkXE!eb1oUY [Fa)k򔵊)k>e)VQT7E)jE)z(i%uW"%-<%P%PR7%e)i%5SRz)VQPw-RN/P*VEYVj)ftSLbz)b)ftKS)RJoU)(",2B)#[:K)˪T)U=ҨM%y\ė.LPBbv+VYE)ݔI)yJJ顔nJR2JL)E 饐 YE!ժw-PRH/d)dY"e~W2+#^3;qtthZjcti離oE7Gv1mhzz[4=a78 ',\MW76MMS]Rc_u x!Ko xos q G=ºp0={&l؂a]k PȭRũcݩS=y^ԧ 'RSׇŕ}78 VfQ6>IUS ,tp=x+C0Jڧ 6 s:7d>gNS(iu'Nu7/^Ϥ:6,OeI9E{Z8?uМ\;ϸ3m;+46hulo|}x4>cV?Bcؚ{}jmevb,&n ;:poz ~O?bX^')L0=!3'ܛ9SPxfy\q \ + s9@;Uנb!"tz,3Kpn~=s33s V|+E| vtX܉.5S43*:1u7M>hAok{93яƽ _C>#AǏ >?q?~_?ȇ2Wx0~! 뭮paA&}![po[ =S 1_K㴵Hc=ta:nǐ5\Os4Hs4Hs4Hs4Hs4HoHo9Q)xOS's tBRz2Þ^o=jz oGj _m:Sqxm6֦5L [޽i^Ox,u'`'d997yd98w Q{JuT .rJ\m5\MfRnTu¿|K|K|~Vsx! *SfZhfZhfZhfZhfZh?zhfzhfS?%S?%S?%S?S;S;S;S;S;S;S;S;S;S;S;Sȼo/؁MPa6fe3ɲdLtFjtFjtFjtFjtFjtFjt؉\\l[xV<`+؊l[xV<`+؊l[xV<`+ <YWO>4g{a<4x  ^/A#h4xI 8Z@hq-8Z@hqo.$} A>A |`Q9(dJ2%AI$s H^.P*"0#T0 | 4p"f1Xp f fWOa;Y(ǖD@>D@>q݊v&;SPyΕ(X`KٯaFnFMEITTn=[OSSTFp#UЩ s|9@> s|9@> s|9@|ZOx7^+pc 7^7vppppphQY7YӍsN;No;uX:]978,ZQk8j Gu8j G}Mb56XC.QK.qKBG~0 46j䑆j\|' '|PX MyWyq6Q8 '(l(kځv(kځv(kځv(kځvD5pNTÉj8Q 'D5pNTÉj8Q 'D5pNTÉj8Q 'D5pNTÉj8Q 'D5pNTÉj8QzpNTÉjԖը/pNTÉjԚp G(P@q(Q8NTÉj'<<Os*rQVT# qdR<_L!d@xQC;ACDux !w@A(AC;ACDx !wT^"ȜRfY&kdM 5a&Lքɚ04H? O 4H? O 4H? O 4H? O 4H? O 4H? O~JxrԷ| X`*8E\/tW< h=!]ry0y5=׋<[;[;[Xq A^ύJȷ oY_BneA>5>ParpCQ:TU#/a0ߌۍ]nu`9ԃ[mvw p7 @mP5 A2H^ y$/e5CP:Ԭ5CP:Ԭ5CP:Ԭ5CP:Ԭa:L^0y&ua:L^0y&ua:L^0y&BЌf=9Z+ǟ<1;2!W|^>3 *1> FWʼnnƉnƉnƉnƉnƉnƉnƉn\::60>^s1W1;D#F4bD#F4bD#F4bD#F4bD#F4bD#F4bD#F4bD#F4bD#F4bD#F4bD#F4bD#F4bD#w r\1:|EsW(|E+ _QW(|E+ _QW(|E+ _QQmyb|ɗ<'`3f6z3,9~6@5ߔ!QY}|J٢td&ݜ$Lbw*Q=>}=0$Fa4 QhF0(Fa4 QhF0(Fa4 QhF0(F V Vjmz3,9~6@=0=0=0=0=0=0=0=0=0=0=0cvcQ"uTc5ʽQWii}*co띖~^?dwwA/Ƴli<[ϖƳli<[ϖƳli<[ϖƳli<[ϖƳli<[ϖƳli<[ϖƳli<[ϖƳliW,x:|

,]7Zh}}q[c=qW~{+qc5j=M|`mڮnlt`]uM5k:\U/`,K%RpV7 PW5ׁA-|J_1Go%V2o5F?\e?\3~|O?g>̧Sna~HF|0 `>|0 `>|0 `>|01%İ^bK {aMX7q8Ig1c1qLU`Ps1sI`' |v0> ~ (s*+B7Dz#m#mBn mD6m6m6m6m6_eSƯ/]2j ׍a_q͒-`mc&,eToP#ۀ4F-P` >vA84v'l%oבϰxPfmhMcU=F=HO']k]b|(`th?Ltʸq|;報BrhZbjQN7 )DD ^x G'a؜KotLf?S0wvsJ|]ټ> NB>>2^&>}ݰ ݰ S6EtTffibC'II~m<~#7l0t2Nff6iff6&Mt2*fp⾟yqqY}>e<e'#znqZh&kAI*Ulֿ6qZd!.?z!&򏓃-IJko5e Uo8BKȠ]-hcL'O0nf%?& ]=fn.z5 f`0׻@ Aix4F̭b=Pyt+g[vU˩NI;)&E2D!C2D!C2E_WEh"RR\JM1)C%Z[Q}V}hc߲s-ﬣlf 8΁Y=ؤ$NsMG\a:ujB#Jlw){8>1>4H'|A׬׬׬׬"1M.t 2(Ɠ_Jh""TD'l5?ͼ"{c2擌fbM*P!LDy|1_G̻y71&yq^GfJq>q }xhffY.RpϗDEK̵Sw!"$фe6kf`ƦM4`@ NX<͜VB8QvM+U{ q>HpU{m/xϐ2ɶ} A1hi{&^h +0Zjpc~u:X;i4z\CY:p v@d+(%jte 0|lGaTh[r4vPN` nrv*ƱF{&gK)w*J#>k7ur+G%5T:G+8: +-޻csfGAjPe)x(}`xe@*P e1*W1RdZ%nSCeev]ȰJ2l$K6"D/EDn#$ZD.TCRt"3Jۈ6NTC-R%¹t\' pv".KERIL fRt,DXՅ*y.<rF/2T "SvN)\0.b1E "VdЊ Z""f籼_M[ Qf+/P(/UUL*f7]:̧@eb> ^9Un*MO&]6ͨMjDW7{DY_F֗6%N{ų)ǖ4eJ҄4$tp6 f'7}o\WV sq 9eW<;A^7b6W+8;PI%UL7[K~#Tr$ҳ):1(f:~<8%`.NrF%L{>03` `cNVNY7Da+Q0XP WBu2|bP*:ÙC9D{wwaq׍wYϧmLo}Vy}EԮ& ׀X+CBG Z"s3 ֽ_I i>b=wrc'qI\vrݝcH#IA2f&Y8kg^2ZZXkmEe"ZJHjrZc7Lx]r5FRح^n>=}R(8{86G$CrX s䇜u_Ng&z>s]W/M^mRk >rcx7^Vo5Tog_DmxgwHW[xn3μ5G`7*X1OSg?!:%(~G([^/t&6_~M-511[*;-te){E*Q!Êx(p S_Mj,<-_-b-yXWo-Rݱ_u|>3_G1`X<%sV "95[#?RFY߃(cz\u(OEMY| ze`Z*pZ7&9 Dy^(wSA)0_l81^Rv[qø_N~ugf]/ 8|<(rk_ђZA fU gy9;r=_Bs?Gt*j/Y猿4o|#. ׼/#8< \ GO3e#᪞y܃k dz1D6"AXx4w e !.4u3ᩭ,!ܽg3K',W,r|#wYrW-\eO ̫0sB5? w0+LkɶF7g\O*8_( \"\R,7sngvpV=`%XC[ 0F7 ǢQ0e[tQ#hTE[@ٖwW1w Uy`Ly 1g\8pr"x"8,C:ĬC:ĬC:ĬCц,*Vg!SEhuFb!Fg$!n!~~G$i+'p" N'S2c~ޅF}^TEb,Kek;{gwQ`QO?A;[jԪSS#HS&֏KNl99lc%2{=5BޘS? dw;(!vU] ~?bf_|귖7捨y#jވ7qRF9e+MG9䲃673쌀vikeEḥ;zc/ {#hB-4aX'K?ce[~Z\6 !|pRNg9u޿ r@С;hw;]`w9 Dxm@\Z㿦gIbzjC!ZSx.׋ƢoãQwMjXmo/nN8hYw.Vf0v죰;Θt:UفWb\:ݝBg 8+`4vFЪ(Rٻd0,TQ̝U\]:W⪾CqǬ_Y\nZy(<)OVX@Nur,]W)+/ S%o|V#YΡ]5~#ⴿPcBVlY43 ά:Dkrf=ZgRn.FP+&9 'Z9t.Isir\!bhd-6[=H]jhA3aOO*TڃJ{PgA=5.EKQR%.EKQR؃{P` A=( j8ڶ0f2VQTփzP[JAi=(m)*A]KQRԵu-E]=z*VWA]=(eՃzPRTՃzPUAU=U5ԃzБrt\/t:b*@(ԃq=AK` ~X059Ѯə9iWW]39h|Uu7l5'ʊDc--7ٳzTXu3SL*^^Şq知er|r|r|r|r|H)ScNJNJcu;#!GYk;FX`e{$+[Y)3YCq*߲b{7154Tbvޤ\Xd;.Z֩eZ֩ezթWzթW௰Y4Ot@:5[=tjRu.8|ǟttp`eB-ԢNԡNԡNԡNԠN Ԡn;/u9F.Bҽtym7Eh 7=«Upj?Fo#/iUq 1^ҋVzJ$u^%>jeօz?G/9.4W7nzlxVry7G;•[ eC*^wU8p=u\9s{hZ~:>?Cyֳu#%" N4Fa]~i(U*YV=`e~™O.~xQigY=:3g2Ϲs?OmSQRJ6E;Zo>G!+FȊb~~{7v;>EȜ2g=#迹zq>ȹü~< p^P>~ Q0zuJǠEKoKoٽa.AgF/^KhiNo8 Y]X:.5֡*fT9j:Տnu"#:Q-U'uV:~G3uRG/uRG/uRG'yOsuo*\#-Q1Tl 8Ryh,TNE-h>M"ۋ?Y]օdO4zb hn?0sG!Kl:3l  6r)u/ 8Zͫ2q+Vj '^)H+ESL-v**_KK9U.W|]W(eCw3(?S+IePP()wV𹌲O+TJ\' er"(E4&ylʟ+tɨ*rܤ"WEy]v7K%-1%!_*o;MPK${2~Sy_AePdJ@eZ%32|(n9* eHT2Su*{X٧NS)G_T3QD-:[-SSCTϔjztջj*g15&g+xuz@F^+λZwm^a^}}2:occ|qVwٙnq$TwSNp v%Nw{v8ܹ<{{Ͻ] p_qW9www3nr79[-_s=Q΄fQ8wDy,ᨃ;QyBVx}d}ow=='{x/x/4EE{{Y{zd/M-[㭓އr,yx{yA;3__LW/S^-mZ(9GGhy+ku ]Kucyn[n#ty;˻uW.>|X׃"=TOz|Jc=^OrVϕ<=Oo77z|K߮k!^b^/YY/Weܢ_+ Vkv@OzJo~;O{Y?lx<O'DbGVEQ*PꞂҎ ZGi2?f-9n/8;+9n3Gp,|~R9cq|;\yZ ?q>*RlߎqfL8v.V . c}Hg pij<7w.~$9И9uq)"HҼ*2>Q tF$iy~ZW"<5*= ]+,)l 'gڤ`^++%5y[ = ]1F?Zw0;NF-/"#~). Wu&G5"6BGA\d3?wgZp|Xxje33{K\e4.B\4ǖՔpڡܝxnp ~,6nFVq<w3μ sN9 (0/rPg΄1] fH~5ǥvhv%0rӂFRV|zrI՞ ؅91spߎoFF9nn_0<9|aJk8.-,_w I36C_ !1Ka :k<D` 庳Gz(ܾEPۺ`mQ09$/(S!9gYެYd,n;yn,&x%LkkȹᖧuP9T/"EdcQ^Yy]A k򜕣ڤ̓BʹZy(cyK]EhWsTw00|3X髚Q2& 5+7pȍt/S4Te c~̂'}bJÿ}b`r"/3`}83ڦBsQP+V >g)8E(е74YX!>V^Y ,3.`wq#_eXپGWtcw9n/k\4\nvd37*P{KUV;ْ61X]웉b׈싍1|+[amHDiyW~-@F8gj O)KP.M`;0k$<ž(XCkjVR źcZv1")e6e=R|HT(^>ܭ=fPH($AŚB3qBa a1Cϙӯ:E RY]ާNjT̽@G*; :3Da] ]x~r3O+c Owx{37̃eH/:]PtH`څ'3 rL8:1-z3j -|=+d_(8*zjfC:PF7@\^7ҋOKRw_XMHMGEDDC(>H[1BbI Ab\+++++++,4S{}q3ι’,gUי\o dwj(d_'Y-9j%GQV+Zy +1H^## <`]nV#<&[̚fkmmP0J'jmmWI*:dVU$#f W_ N#SjljzʎVb{Zكy-E=R^GJZu%Ʃw{<+1ו>Vۓgj=EmQy-O}:~*U$[^Vr+#%fY;^nV4+G[ݙe6JJ{;۝m4Gػ{ϳvYɬ`wC^~P?dEU^W' Y >فY !co';o:gJ@95(Y`IJraQK[͒ ["XWX+_eĭ[Uu[ |:l*Հ=ڰ5f_S5GZPk %AG[ Ih;Ci26uq72jH? MuiMA SB",d6 yp|~=lj {lc6nmBM[amil lc+l" w;a.gA됄>jOÚG l'z3= ;D`УF"ݥwئ6Vi Mz !ߦ _O"'cD)ZDhhl3N;]h:pՆ۬~Aty;IuB{eQb@AQOxTUhI _%iw1TA Q m_%}(/"N!<,ʍ.SmQCԠID-Qڢ6uuDJuE]JD=JE}j(Es䤅ht[$䤭0$t=b0X Fg#hss$,&#1 y8_\j$>egR89TxS85p; iA͜N+JtdJrRtt7ur8CI8Ü1ЇMB\\Le_\A fQ3ۙM9gVW멵6UConEѲ ه\W%(ѶAr`3k2!9r(2=%<9ȉr"U44QK9YNT9ir4/χ t_*/ENfȗˑ+fͳlh#5Z9k:o7"Mf#o[學m8@.@N"__vy;4!;=P.^y/HTY> >(D܇C|a c1|qO@|!\ \.}^!W*^!WU-\Z}!b}$7>,?&&[V[6zr'.a܃+AhQ 2?!r? p %ݝX ]jJ2.P5UϥD::jsAMaSU k៫Rp!UJ-m6jsýW߇0țM Aސkk!F\o MIG oO~Gjw;AB~WwQG?O.#YYG~?R+?300IQ(C˚h7XFa^qA䱌0X*c~0X&c:{32EXG[2è/ꪌ0ɨ#麌っoFω[3zNf٬'$77߃ a;ҽ SCwa ݍ1t*'1zNc(1غ8= @Km=v7o 6п \\gw¦Uw}@#z7 F`S {*c'vNQ&p|OajI|M)saz1} 0=X QAT?ggg^{qbޟ@5v^O Hhl4oͷDњ\>F.RD Rl/:XO#DE'"迗ob P#( >=c+? ` NCЊ ąTY\PI\PE\*.j 3q헉YcZ%抹ׁKpEmf>3 O,n2Aap.3e0y3sa39g0ùF1s8hfc9bp30sa$3F2samES'U:[V,YqW_ݪN:VRV}>&Vm6Tju;CcTӬi$ δfkͅ{um=l=L''ZLCRjhhwgߴzja֌wY[ÿGͭqlP#,5=ۃmMM vbW+S] nm66!| ^4jw\{.o{+p k vT|EթSQCFHZ SJSJ5Rwp:) m ;T*ݝ4ӝtJszM6F3*댥 ιιsQ3\KkMswŀw]Dq`_.3.Z2|3י%1+K=dpb}Ugɳ73`\C 1,%hp*e\%RU%0*5p ^ \ sd* U1WI`\t6cnj3X:0ciˌ;3dVE\[ҙUJ5^z+BvSݠ9Uzz^G9is2ωgӊyNVja;v0I۹\b=ryRyCtՍsXP X-՟խUFԅQ70pW/μ(yQE1/Jg^̼̋z2/ ^rkQ]z F̌(Qz^=,WW/I^V/\(FRt _ަ8SE}>d@5  !?Wݤ6 1W`GiEqx^:wdh]GH{'đ~P?o͔_a3R1I3kfNT'ưaD.I3w;0k)n aJ5r1%f)5Gj仍YS39-to㶁? goS%NU;1w:SN;`T۝ND,à0 FA]3_^^ Lw&ŻWev5)9R]EC`}'ݓzGD&WTo*)o7{{ o zk@ϼ3 Hxw, `Zh% Ӟ(YWթÍ 8BV:v4F toݛ辺/5u#Yw|/YzsHW!jH Lׁ&poַ5l0 Nwi <0 A ^Fz^pWpoS7~].7pwйG4WzG S)~ %0<3n&0L 0`G?Jc8y`?Musu'(լwM-EfkjRAVԄIflN` &͕;uCV|OÃT?ߙdvS/9g=Kn-,ly\Yw|zMWSO"|vNo]DAPR)tdd8-\j3>qT=Ai'^ngG4Hdl…lɯ͕@>SIWn,^4%X9yWfRN15/_΃J=k}Q?PvYyLr-1M,EE^*WTKMNyj?=3Xicޖ^{M|x=!FjCc:|f~-o0R _e7KfSCktԧ잺e8SmY!fɺ ,_p̢R^ؑIO8TK:Kß+3 90p@,yǹKaroW«rn)?&^g<ͬvLOyxH4k=h&["OM6^r̎$VVL&MQVg+i՛*XTb k5byS%k5*[iTźкj}6vcvԦ,kճ55ovצ65PMBjjgGNM-'zZ[ZK)z;[˩*uVYoPG--bkK]R~۔szZ_X)b}M}[[X;4kHg[4gScNX6UQO vEbW+4;ήF5t]׮Gvca7etL4LW}Ofe㞠dT4-4.Q7E=DE-:Hk;3.Jfe{[.ښEqYE{jv\fe,z8;*&xxbk%feqӵUfe1_7խğuYnvVwŃfgeYYD ާ,Ͻ/{8-y۩ہ;мno7fK Zh#jRُqjꝤ)52LG}[T׹Zkl ! 1 B! B!k-Zc j@ 23{!k^.C<XB%Cx C֞w-si}g={x׻{{=ރ"?(ˬy1âfEQEK?($6,S;b w P6`rx7Ĺ Rq)ӈrq9ZJ$1_G((hZ,㯉_58c9),6>L,b%y@18q:oj<]q3J/ĭV(y __csX/>we})K88JP2"P#be1y,F!#0g1ҫXC,Fa#bW<#}?~H`1+Y,F#Hd19,F>#bc19,F>Ox"MAcXCvPt%O'S(F0a0 ly׹d#&Հ;bؽ{{[mE8I=g&1G=v~Yva|@Eh>9tz8Ȟ3dO`ȞȐ=!{C:HȠK|=Vw+|]2|;`O#cYz.]PϢğb'GX{# pL8>[=!Aa% C?+w„0>>0 {sHX!a1BLML#;) -f^!7&DwƄb%1oļ]1o1w1oQa"矼y Cq,hFD2ikV8ÿoHfQa0\+| yWf^Ad>`)7\6\4V oj a0 {  R-`ђ Hg>`3_.d p| Y\eŅb:\1i,r!L1$Oe,r+BiuP|@|}P|S1*qo B!XX 1L`^!y,+> >-> 2Cg6Jc9O\+~ׁ00)~ ||3n#1L`># mp,9O|Y|(Ȣ@Q֌n,3Hȅ,r!L` V[#s8H_5^V7-Xۨ5zV;MhW5m ԪjZnR[xZR q#Ɛ# uCK9pm- O3Hb$#Yll<~mP;k0.ZQϨaUm# ͬn&ڮ(Q/䤚] ]z= DvBsd݋0+ë;aQMF*"͠pZ!t5|(<#?WGxp7t2$. 9B7R$.E<%\Ɇںs0JagC<^Ԓ:f<}I(*P c`Zw݂>v Ж@d6q\hLLpS$9"Pep(xZA(>K eCeBm ЖPܻ8VX s g&gCI塍U VD 7hR4><n DQ-uG6&`עި7\-nGGGCC2=- MM؛].E9vF-ڠ5 5-QM;[; aގlzEC A00H $k1ZLk]C0zTE[\\smV5j`X^8 S^V GjZA\4XXUj[֫ hQUϫcZ%;@u2);K#j_82 ^c"̾\C[:Faġ.c@ %H7X `߈IEAZ>R:{{t"/sq.*`iƏGP!{Qe~?gqz ?G-x zoP)މw'qnGe-z1 RD3W2>,RTESh-h~mĞw?|1 Ldo!=kɟ, k:"@oG];tiWTNݝ`P.K ˭V r5\ zmECNtBpFGh5H?+cߕ8 :t4ξ>OCmO{R|_>% ]F37?7,A;N^Bw7qp}M߾4?_"Yu^Jߣ^H ˄ePxRx?* /"a ?vৄWWnWFW { CwK8%>F3}aT[+NW e̗x!ِw66FNsp]Iw J>xMxMA1ML!`;q><.Q1GįxS<(n7M&<$֊4}i6ц/.ч?eQ_WŽ^|M_࿊Cag?~#D?%1g%T{del^l!y0(Ʈ-!;Hqӱϒc)fFLlul5zLV-cROZ,Azە]MQ*QljUj lfUS:,x 5P@VSd>7Wi*AJ{=i%kJjQԨTUZKqi9Z kv*6ͨf}rW#8)If `K|'rUA 5'G?ŐtZTaZ )KYЧST:A JU)grL9JR BJ+וԱC5 jMU*WnjPGYunQʹ6T΃<-ӧ(ZVײ@Kj-AնwAϪQK R;CPB:AS֥uhR~ HiжaB =iPpg{==7 R qCp0q#=Իe@JC!G"TDӐgP% }kh3{VHYhl|B4!UTNDÀG6MQ=!=%x7@&'h7ţFqkBF##}X%t@C2zS~7 aUoG?e_=:鏡>K!!z5k4NS??G?zЈK4ƞh?Yf7ٳ愡Ђ`e=uLMJyr/0mf)Ũ5ڜE U_7ShVPd39i<ߤPm3{_s\kcvѹk{#M+, ^{ԇ|B_om5xGL9S˴»IYBT·;K'3\$W[fy-e|HۻYMɗyNA?Ꞔ<% _ ҉NwS'+$oݟiZ6 M~ _HWr qrl ڕ^' }>=O'd}2zPOAyT}*zHOCt}:zXX//A3@DKKQ~~zT^TO~h1Q>_l \  rA7 !*B!*~% =^{qǽjNǝFߋ 9ø~k_ZVWvst-u:IRG95S85:Fp|qMvprR{K${*AjZ$g2뼳튳Z^oun[:IU IvvfAr9IBV.ٍm΢FSrV5S[kYّH:2+;;ָ5k]Suº26;K,JwkM7%΄Bڳ=sRs/q^pN\{sw{s^v8 ۓM7sS{j垭Z9GyHFcLHH.rYSi!lf5gmeiܨCMͩu:n&r Tuޛm3'5tmn2mƼTJ 䀜-$Uc+9Z2`H-Smm&uvx=]'X'<Hsȥ5jŮss3Y'0[K&0{O7hNLYWteOcsG{Ӹypǐ9PuhdH!(uuʱY.%zҜ.g5Y4W=E%Πuw6wYs1:ol9T$zgs<.W7)m{ǧR1ϳҳTrWg5ͭZhP)otݣζ*L(blo6z砵YLwQsqO.8Ƽ6{=vhx[1~^# ( l0.@OBJck Za:[+\ dKЫȎBN$|jto1bA3c}>ɾu\9qpp6p3S/2~/1~Yv,/C)V-_f88S&Tb -&^.4O5Oؚgl5sSs2,* hKG%G.Kx>/q!ŷ^r^/,,S~--~"NF'^C'~2N\L'~rM\\ӈZ\J?Зo+k5t]uU@U_"NOįGt]_miؤ,'XXc8,,F;)ů+x?'~~wMO'|9,~:us99|kw߽Ŀ{/}WC=#|qOW$i! $!\ a HR^NQ^N^tR^N^ dCEbyKl% N~):E7CTۢ&Ȼ F 3F>!#K J!`W?%vuln0B}]y[ Ov99cU 8VQڀ6v"1AW̥pX )*8s+Lj_W[ŕ6Oýs~ 5Zkg#@e̾Fiֺt mWq#JL3{_]lܝf.۸<;4c3ll0TʼެͧZb,I }@%IK=Ҹ4ekuu^ڈ-ƶؖi[n[aˇ<[!OP&|Hon7%RzVtrdwղ=-K]c:2ꇚ[JZZ9ǥ1(SE -\77ʹm5Y ,[w546vt NZe,JrՓM/uƄk)f4hݶsP4bfleP3U}4{}>bۻ )imԾST_U*~|rk- 0̀^lVy9)޼vVu퓻[jڽ'a–xs9qm;sp|4g!'-e&xR'a$\0.A3Ҝ5ך}Ty̲,QJLL,c=c}<]VB+?ݝE(Jb1)1%X*%DceJ0cuud,Sܗs<͹;sg}\y[s;J$UiP ۗ`㷨[o-/A'$ȧc0=Uvk :e0tjoߺʮKݭGgsFPp/cgX =}AubkئaI:])u@f>W͟a11{apu^빎Hl'L>뮋NŲXꜽx+3tg,mo,t<|YAgAgU'n̓1j=lQ4MOb%@"ZеԈk;V6M8̈pIJc8cy$i3F-;wH&pt<%Oȏ<;f ~[ct1q`CX,Ƀ(WXZ[=(Wy2!2e RfYwur 3Z1,^\ah%:{YxrdѸ7I%pQ味#W85F$ Or~^~/N_E0rKZHYpDH'\^%7hն-bldߖ癧vCkV^6>:-P-ި}30OG{^}Ntꢬ5]J[( VQmtV,ųˈn'7Ub',KAyvbJbFLlݏ ]f"+J &bŽ @:р*o5^ɵ`?CA|.NE6k.Lʐ+%7KS,>boztgצWFDy]غo'TPzSó$s^:i>3~BZ$unOc&e{ \[y顴"M\^aRery+]^#u.kklz#Z!PC5<;69o5-UzfMT(' gIhkbmae`vϱ37 z操T륧)璇m!Y=esZѵ ڵ 5m!"XqDcZo@"Sm _}{==R :^'»\EǑTJv bn(:PV 䉋HR$ɿd&"gzEai; o$ЖJgӈ&RKyL2ӣ5>B(n;(9}`kۧlGJ[D $3ti8#EG`U.ɚ))1F-hrtIhfe%ZRwml)i4XۆGPI[̴ "7В>ay /Rk{E(:û]K.9*sJlشg:$ C9fBFZ|A$#҈4a=RG2+"u[_J䒴i [54=:-m\vw %Kweަޓ"o;6r%{ ϒ=( Ȏ5eOx|PPg͒R]R>No0r/6j+=a517eBoċױVU:Z\DC:K'bgɭg3[lW{Smy|]M3!uQ-=rwdd==Cm;Gg$h˳/exJm7:|]<<>EϩjȞ#r` FgL9y*Rً#b:ޅYJݠS݅ Yc+xϤxQN,yGjeU֞d͂sϭ]R}:yeg+..ʋy5D%\7h+(zs6nLj1@4Z63bt GI>h 0"Z% zt4lb;z2L=jUG2c_`xn.RU=ũ@XzJ=%^>O`SPDT\}et<ߌˉ//>00;=rP9ȑw+YRb'X5ʕ ^wQʛPT&=7PdByUț>5A2&eLʘD1PA2&eL11ʘ:PԉX;B,U1dC(&Za?Sx\FYa'(c_Ynj*!}:~Wҷ%·CĨh>#%4ok?VsJUq Rkl*^ɪT͗5U%(9HɡTo+lXaU%J:dO2%{R]P'U=I]e@|8$%R}1ޣbo=?@bCeujRY]#^WVWTCx%KRr_QrJJ 9TMܯ)S[JY%{+UsJWdOq!{:+$nkqC<0/>Y_Y1UX\[ej!潖5j+Lj S?br6yfҠ6vsj#L4_I !NҬc{鵦Fhrx٭)7-r3e6́{1liqe5̜/)=}ss53C BxO㋄eaj}¶"fFl](b6\[!qV[p*(^op&gyC"%t<;Z0= MަbHۙfQ$BkY<7 JBjxX#r(9tR e ~ [?eŷٹ&!6$ [t,1+ pnz O ==n@Oԗ/T! ˡ),1|B q:wBwCQTd"1;tl5y)pw6ge6d-6ܡC"{d֙u|.>dL3eCD)gg@Ag3вloV$Tү%6S87 g@N 7C0~va1}xxʀ49 mͲ=O]!N KK1s¾J3B\4Pя(+ H$vp6@&p"hO((HxW3/E{⊸(DX'I .caO#,A >naNZ {\!_dg, h,&Y~ihGp_41yVAAⳐ6'¶!QfsB3$~c {FH 5~ -ipg*#~ynQ8#u JX9i)B*@acjA6#={Q+l+hU*E=&@G;Rh7څC#dI6ːx=VF# D;TT˜bPLLLg \_ s s2 U%30y']m^_Fe}ԍSm2_A!si7:^ې' S|&CoMDOq;Υ:(% `~3*JzZRFMo[8r\ ̉309.F~zĬ3 ma\q̋,%@j@50$ ?Q T[Lg[zՁE0et%MCQ)~E(Mf7EQ1栨(EQo7EDQo5zkP{E:Z֡EQۀ^z;5g mF.obhM(bVb)%žD#/  ;bwc% qψ?@\Oq/լZ~IŽP (ME1GP bbS((A37B-%ŋJ!]‹߂8w N߉8}݈'ߊ8} q>C~f"F~1F2b促7*$WX"?C,+%DB>+ GrR %T)jB U?.6AlNP~iV/x ˠv;X?`&yP %Q D-YI,P UWVoY/Ĕ44 `VwtsP`?fK\AWwCEbpš1YuTl`3ˁ~81ڃ@CZp1Fk::38t&ҵ5sMs)kKko05ra: =2eZ1ZJ6%s`3\{& #|B_-ʤTNy_0eh*L OjZ%#!\Dkgij:h\0tpZPc)lHS돍x tKEF-VyL3xs12 t1 %cC _ܪ79b5o\/KZ[ `j4̶ۚ9˛e FS}"駯2´qm̺潖kOnn5J?Ylb0M{%@/KnYJ؇t$e7ٝLkճWZ.<5˾fkh^dǂ ^=Q^[m E[9x5\[bJdb,iشku+^wJaWѼm6ְo0F8h,ŢX*^۱nHě[t)r!,t"z0V.Ӂ}Cu^ѵxG/΋5[tv@@< dnWXӃ3'̵ݥQs}xiԘ``fE~Kc4]8fWGAUPM߯kI3Y(x<0ؾOlTM Xס.<_ѯXJA.j8ԯ\;.Y a.D2]ftB,I`)t%œ`R-ٜ[޸gq^O {p[|AUpTJIk+S̔YzoNs/y9c&kl*`)6cR -t)UpU/֟- p΍iaX`S\U=% l!-(n;8S ~1hf\2Wx(,pܑ#N64g0Q,+]bxR(;rg-^aQ(sʰ5Cݮ41 qqҼ/ZDV'ĞӀbϯB9{NlC⒐-= \u:oybVPlr|5Xՠþ|6/j Pyۗ?9~mV7݂5U3/jDŽcYwIrǝ3NSijosߠsT:kH뫍ͺ=W4N~K}F'SB/P-|>cqV}uuc5*Q遡irh0Twsڝv]$wh;v-˿vǷ5(<0uA^pf;^KfYn ;Ue߹c! 2LQdpi\Biүk0koAtʜu❞˲s非ir ;&| }e\\EJ\Tƥ4V;:g`죎Ѫf_˗Y^;]mdž1+3VW{_4W4꜆w}$_bBUsUsBSO]~:\ P)+>5?w_۴@_~_;;z{>3Ҷ*ǰk=W>jk! md[;i'EƭiցmT5: QШ䖪waca$8߽6&}F_aݾU߆o۷?/%aDP |!o/eY瀱L~r߾O^OUx<v#^ThmߞQ'0<:;l˰O#&9xӋO}\cE{OC FYU,vMuNu::YTTUy1JUUnUX 7:w]w^UB{U3լj奄Eb!&_}T/T//~)֏/W_B;\ |G\}s-h}}ZC\9j7~7/_b/4(53 #x/& {-~ B__5|^5K*N(;k)Z?VvO*;k΅쬅&\G OK%H$&0 J㿩x^K??Iv·O%|';xAwV<2B#o)/Rsf!GH[#VC:UIVF6$ԊHŷ51o|RƎ=+|Ș򼷗to5;]L\Xy~uH_swuFq҅awmqGޘZVw~NW4T\\}aQ-ϻ/n |τBFP>*&>E]\+j.&YJʊ/k*R6ޒʌUehՙkv\&{5,a a Ϙ1.!,15ĸc᱄BC0s]s;&yywNOߺu_U*.,tLڭ%ä8Kn%uQK By&}hܾDs`c4h;zњ+֣}75e۪k.TCM"|p_モNʎbzP?r$7:]VVFO#O]]2Lbc B[+K7ٜ; pPi;eqGREkF"G9zsLʲcP 3D^ KtVfEʽw-Ύ}w-/Zo)hgS>xCw 3U|-kcF7H/͘or|̷c 11Üs5*'Ōƌrq.6f2f➊sL{S\3g ϹDee/_pI++/_r««ܻׄ׸b=#v*K-vjx{#pk^Kϊg9xN<ǥb?&NS\8-Nsu:xCgn8+rUU.S|M|ӊs:xӋw;A+^\,e&\BZwJ,ӜUz.n +[z7'Gz/H)\*r6)]JҳҳCZ'6JR&W($I2JFHʒ$YbID2KfTJVn+reRTmIMƸ \ED-a2aLp'L S}Tj̀c'{[2,'#Er!,'2mr#r|rOG"gHo9ˊ&gHғxM%ke9}p>m>arpًrCJ[E- /?y(n-K0}dOl>N {!3o桒¼pWx4p%:"J'Ih"ƈ&`IMwJ>c0./ /ʁQHZpko>h۱*G52괡:sVEzi4MO}“Nz5nGŔg/k*[oj ;_$ܯuأ uNLYldu݈;PEۻhOnv%Ņf=E%ڪdE>^k!Vfr{Ld+ 3Ү$-z^V?7Nޥ0g]Çڛ&0KJI8_$3Ƽ`r&7D8RG:#5R/CN"]h"R"r;p{_>築"i\Dv }mD>խɫ[c HL֍ԕF{wT]}]}XhwojtXmJ|H>n ˲j\y.glHjj S7I&)!}_ m_[1/D.nFD9z _ _ ߈4FFW#cć"2ijO"C[![z>Ox%Hn9g7 Ϡo]xלo.x5 r 9i |}xoC{}=o 2'-C'sZ5~?)!ZGUl`<(; 6Ѵo I :PF+gZ^@(+Qbv|ϓJ'ֺG)YVhGQM *R2fGfVS^/K)9k8Lōz 4^]ӨηzqKr[BX`.\L ܶ7&SyaioDZ )޺֤Od'g6usAJMR!}gif,Q3{Ҧj mh_Ҋ{dqP?# DkqI:bp:p:x'x?W}B_KDh00!;Zt-PzAɢso%T#=/f~%A6>4)v/:L%Iq_/ }ݙ6ZqZ(asjy>;hYb`;a]i!ޠtN7sHDw ^);o2 ەӠi4&Fg&UXDo{ɢoבSa̻kj6,yӠ]3])1˂?QitM(5˕ K:.[.h|Hkm)T+{tA~op^Yź@vEɩ 5FZHA9`{3A{^byd\3-rvS>'(gW: νuS9k6CNz+{6%tG<3leﴏǿ+IK~G ]iu5ֹZgy8 9W眗ZesT=oWe\ڹ֩/䜕 y8o6Γ=+Q申\;1j y%N>Yrl8iW*xrQN-tSٝ&{cӴ%wˇ] 7XK5Mg=2ZJ_6M{ouu\!8@Ύvwm>澻kѐ`J9j4^*5bIq`{4fs.]OdVW8}do4z7:8<٠2.]מk9Lծ}q祔c}s:e8])(5]Om^s.#s)ը=:rԴLe)m^k FôD @a mQ]Et(%ͧiżqJ@ʭsҪuQq].K;m43+݅Z:8+մ]3nmzɆ\c -C{ab3e~$Gm_ڧ1\4.7*j}\mC jc]jpӚ<5z_>i͵̊^j`{[fGZ٪w-f>4Ϙ:rH^ 2>OߞV[3Ywdzb}8sdٚj.zͼYCSr"մUܙzٹ;]u<\u^{5AA)VZ ^m/eis&l^g;Vq_oӝqeד55vo'MI4ѹi5Lof;od7*RkIѤ-Vr_w>t>L?7 5 lDK9>j0:M J'DӽW{=BC9l(^p/z[= .>ϹsL ˇS宍MgfU]y.VWNZCkiiYq]Y}rg Fՙ Ǽ wo{;RǴ}0^OjEiglo#=;=ރfŻ'UkuzYIߝ"gIZoˆooW6ޭͫ۽myͼړ$y#Vli!metݧJ\{7bmW UGj>w 7!ϑhu5\]G{ 9ӘsNV+WwiWggiu5 ' Gm J'yiC(=KͬtWǻ.\WSkխNOjQxz;1{{ cnZk:ov-֦]tt-<;C>ewFጩ%CK;v1%Xo &w]7Cfܮ;qē#}߹8Nh~XmKxH nLTH^!m#LXPȕ\\A!cE1R(_QjE5 +jɡ"$I`rrM?BRPtI w=,du`[ :[fu`[Vuo⭃e i9 E>q|PBx 8 E5{ah@>ܮ@6 )R6 u`%`&EtѲ,\B0O#,}@k1A{qkĠ=S: gJ ແxwL<>ˠ裡~@R`> r"BoVޅ l(x&Ywq?') yD FWń@P˫v"f聰j3Ai89'B^Cw }(4_]#M0y۠;~֓ӫqiơwՔlčBQ,lg A#4.Nq# 0i:BO繇kiEjD9lWBFsnn/<2>W\ƅǹS(wt O"~?l{r3 l=ų> KK)o/R$HCLճ`mxqVkx'()ܕX/QXOmBj9Fe#<}K-GKoz"Fy~ 5؃P.wQ6GΑي2 >#>+0IhP"0l)CTl$}@xp{ M@p6Q4#S\LOd c9? D0%E-Rb۹OߏIp;c(U \.H@bl[s@Ƣ=8`2C`i/4 "e`KqoJsD^a7 Va Rq ,f@'33XnYAk^)%JZ@(qhE6g(wH5 yb*xx,K sC_!>fFȎ.0{UaeIJ6%QO3@6^U|躖G+٪Jce_aH |#hq8Xf' xEQg# d6JeMMxH JCoP'?d,RL?H%*0 }#,:EҨ0VJOE4U#6ޡG/y80+#V $ 1-~@,G!oBƨc,揀?aA,8^,Nj Ol}uZPG+o? 0/k'oAsdv X%GPO0/u\F:*7A۔b<cWatW#f?VBMUFR 3 YaXX0L)zQ?%rEq8Aר<|j`Z 8OI _z \ |"aV(~ e<4_> rH7( ~HU}8} ৗ Q1)Ĉm πw~r"'Zxl-K׀, 'L- hACZ#K),!}X) rc jrT_Ԫ,i X!\FHyHs%&hrFCЏB4Ex9瀟A+?8H_qD4끰 X6 м|+~_}&N8 f~jT*w Jh1qjEp3{pBmV0z *^uHl=J@M/9g3ڍݸF{'! Yqgt ?M< OKtglfV؊ V[dpyS0pG3ЯggX}9ID|/73\"Y:/sIr9gD$Hff dD *9I1g"3}WDy܇Q㜣 RZSַ/ou}-~WBt- )`sntMj^G?8#2(/#E+ρdo`.`XRZ'p{ \Z ;pbl#r5ڂ𷈳nFA-"-z Z}'נ@P垫h&#TmO l| e>닒Ex%p<p+3fQ }XE JB69}#f a<[\#g{J o܉wr}j-=?vj^<:*S@?[:{9\d)+C祷!GmʓxGU%ʒV{E~dgy\gUʫ1Inѣs%_L݆ϱe?(=ŹR$q.KϽ]!e3j"{?M0cɳ}=">ϸ%T=A$ ˨!" 1sky2/] c5.k keRws zrG](I3o/+|+s(s$;v\[; rfEl[PmH P]C+'7ؚ -R7"</%Tʫ8C]=NCy>#*@aa @y|W׀}٤(z2v!rY|  PyUm>Rn΄E,JؕKcm e9'-<ϊk%Y>qpj ?Ϣ$gdb} 4UOH NIlDc]p9rRyf2 t0nC596(5_TN 1ܻ<*(eFm4um^jS֑IvyHm"$ہBLuoVvyIOuEMŕYE߲*ȗR^W\˾F)p1D.xL |˦SIc;O?,`8٫Ϻ\ziDݼ ux1i f"ލ41 yDԯ b@b -(VT~sP~}^CLM,r^V"=8Og q&>?}*I%i0lX\XvR;kX]4%"("wRj*/SAkJ .EQ xB~#|3 - 1BZ}bc!ɺ$S[;>Rm ̫W_< 1nߑa_Gr#ǁ޳bWxڱuo?o}\g1< l ^h7 6t/X(_8 نrR=L6pK9 V'4t6]òYA(,,n[hPRajQXfR]aArx a 7] )x?GG@$p>bC?A"C:?BaN3Ȍ67xDˆ#lϐ>@֯4z3 n^;> Dl![QPhGEVUvZ5߯6vc_Ū~f1pPoaZagʀ5gK8 cc0qy:1t[vޝ5 BdOv4e ~ozjH]uWH'Ⱦ].wA+K?{ߡnzEбiS`-"8Ok5[-6~~ 1 #MZ/K~w #`}r=n?1ݏ~EO!㌦(g19ty?Ԇ#>|Q= $P#}\_o IHs:4(w~;P»%ÀxkWHG` fAF:jNVtBn 32hV*τ}6~u.B|;ڱۏ~{~d >~rY ܂rEIPf'3+BNg;З0¾- 5L^C^mX/Iĉ)yzZD9jނAɀ(|2(yFȕ|  'W# rT/!O^mO!zzfB}@p[e"w5=ED^2Gj{ TUD . ^]#< @o. @_i[Qwp>wRјg/XQY(|*X*"sBY *^T"orXeٔj'=~&Wƪָ\<(a<-0VO llz*5K Vς~Ҫ#ہ7kGw/}wcS#"G[A5@73^> \| X)Bx#p'pkDTk_:!~<)gmHSxjtRA DMU-nG^n8 +C@֪@~9j]mAX>b=iny>t>p,@b`SXC=nO3Wعަkkު3b//}anKwQ; b~9g' ݽ!8g_L1B> %;*@ڈt8~u85@o՜6۞ˊ/) o[ZozVMu!|YS'h~4WWe]`XK1X2 |D㿵^tQ<DFh]?S}C}Y{{G{\t7 c&[N$$$@h0gR^*B*դԊ睊#!4 ~FP>*J<;F!ԋ$u4rjݩS+jֹcԫK綅i>R9kS1A65fԆQoR_$0ChbGwU:βhKi:9(uA*AUԄS;N}\YPg7N4sBq*D%)7UzԔZP{A})D#h,M{hFRqIWF `v`~`#ǫrF6.>I RCS3$%JV+[`z1tN`~`Q`i``5`)t#`;`w@`2p:paC%eF0Jo<<<|o䘤WW}c1`f`N`1VV62pt=}ÁY\s KOW׍6zpp U~qS_/39n\&,,氊llaU8 3nB88pp59f+p Aq KyWzT(Ŀa09pu#uAo٪%\I3feyX`[ƒ%*7oz( o*̿DFBo ky6-Yh":"EjEg⊔2,*& S,XߨܪZj樥9:Suѹui]K EkJw[*wu%x! ~G?vӵhIOf5cx͝gk4ҕ6~h LOw m~^H~:n̟~^i Jw4m~%J%/H~iMw_<}ɴ szT^v80?]iox=^υ/ֺrPy`RVy5ѴU_~e-aߚ\諒N k4KJ5}mOWҦ?p4FfaK8[SOLt]}.|G1b߾B˲,U9U^UPqr1*ȟrVp9}B }F$vZѧ:\]WnVS|C=8J Ev_u]AݭtȮr՘6/H-q]dsy\. aØ/171Gc 'OxD+PǕ?“xO}b=/ Kjm}2 ?w`-lG!&>[r03̽?N&4o7iOi i*~eio2#{oTZV qHF   W띬|||||||||||||||( ((     hhhh hh hvmvmvmvmvmvSVv׌gIs߽4'i=bGC8l>N8{.7Ph#bXCċ,-8eoY[V8e oY[-d~Y!ec:*ʦtL6-l-[ NNy'd7:-ʽtFwyY^QyU^1IqYχ|χ|χY|χ|χ9ESt񢙞z)Z15#1-#1=#:1##:1v>7Ftևaq>.>.' UҧD7>UFtSeD>UFŧʈ|ŧʈ|çʈ|ǧʈ|ʈ$>UF Se >UF D Đ@J L`İ Dp>mFfH>mFfh>mFfD26#i3"O1O1O1OS1O1Owi3>mFfL>mF Y\~_dC#M6Z651D7T6Ud+SԕmLCP5-L δ5d{.;5fì3esڜ]mͼcޑsA0ߚo]v-{d"{ v˳,N{%+vdr=aOȉ=-'ٷr=g)H95]*n^Ve77ԘX4Uɱlljl\J͉UcVcKbKԔ3jZlel;6V͈={Q͌mmPŶĶٱmݱ=j~~ v>v^=6Z77VK-ՓvjYsZV{{jUěj5~ |ڏzOQ/i?j6&O|6e#PpĨ;j"h_<] )t@G2uq%etz)eanna[X-,o{S>},<5oqG.;[zKRT-#-c---3̈23zˬ-̃^zB +^zJ+JsFe۸ܿQ9^%7&] 1iqiUg ZAT5Q} jDX1k5a AԜ5Zyj:NG\-ά#tu{^:BXG;`XG'kbެԇ5FPJb45FpAX#(5ƲFP kMai45eYt?k=AsY#!AF%P%!UX}Dq1}~K;{N'a'VvX52nuVdeE5\ԈZR~77pFrvzW NCܜ.q nВg^?G/QOL;\tF:JH'$:Mgi2i:}ft !ͧKt. I¢-QYTMCE=ш^MDk-ډt@tȍD?zG C&FGb@I^ kZwY׵UC&59]B.K a$r&r!2ʝr$="<.Kf(o"^^yEQB WVE>U@UaUXTEU1QHRD'( Lhb'"I(.$`x%Lۂb{0'#b X,+W`[d0eyL^O7L!Y1dSTM5SMV25LYt6e t5Mw$AflaݨY-s39|arh.Gg07 jRJ+l W\6Ζ.&w\;W^;.y~b?WfoF xH+YA=͡~Ѕ=#tRtTn=>:#P}$T?==GOEOѷoUwgGE~7ˡ7rr-<|XX!=V$VR֯nݮ߈uozz}ޱz,I Gc#c#)]9U2mzzv;鬳~YoYEG)ᬢYEgxfuVnC%θYo"^QYMݝ&ס&Nl4RhbzV v^gLWķw- p[]h[-o#]xq?A\#~]xGq?q\uGpN5~m3n_H{nv=~?wPWBμr潐3 ̇!G> 9qȑOC|r#_2_C9uȑ !G.6w!G9r)Bu% 88͟#WB=Ր#?)PV~9Kș!g~ 9s3o!GR=Gs$!=Gs$=GHz$"#H"9ƒ H9$2x$2z$2y$2{$x$y${$rx$rz$ry$x$z$yYII9S0L3C 9R,H#%B 9Rs$`$#YRE$Gʄ-Hِ#B9R1H#CT 9R5H#5B 9R+H#uC 9R?HPVirqș&!g) TG#uXRx'ˍTF|-ߋ_ Hʙ+VdQfYeSSP5L W#H5JVcTR85^MP$5YMQSմ`rbK78Ɖ" ΍)ׅL"RSDi(*d\&(.3̔Af/\9&eU]L &QĤ$7b:#: uk7 8O2ZVjZ8s:<{s bK#bT3IR©•d-v`?wy:RXW]rE> GI-UO|ZEX= JcBzAH zͥW UcT5WT^uT}T_OWTj;E5T#Ո}U~3̕jIZV)PT;2@ֵgo8sonjbs;UWMuW=]z$"SS\5wR\mT{{Qutq{C{S{+{?V+wc{3teorr1Ӝewq8?秷SHjjC]X'\AA9ZVDDTD\$DQdEUdESEWEQPrIQTE QREqWʉ򢂨(*9Yꢆ)jڢh(Ίi*梅h)Z֢hl謚Eggtw.zDOK}D_gwvN(bb,bHcE'Ƌ b&)b&=b)}b ~U(r*r)GrLce' r$')r欧=r)}r|H^?_ )nJ* QVETTT\%TQeRUUeSUSrSWSقRU'U\P% UZQn[Vnv;NvYߡ;uWMw=]{>zGzNcufl^6[+ffU2fyݼa4{>0!s1G1sܼeN;κs]y|`>4'S)Skw|s6%7lGsd/4TKҒVYmk1 flffuvXnl~[la[lq[–li[f:[`+JbjakZczm`F5U{=s0RHi iH)b4L1 ?biz)R"SCJ#"RDDJ(Rj)E3Ticoo}Ob̚5ZgmXU.oCalw<\!KQhy|*#ߕ'Qr\9T~R~VrFrVA|\V>%\DDePJUjj6j.qICS4i~|z=FZHoAKt02-%6:z'NGБ.z7EG1:~qj:@IY~Q-RoQ_R_V[6u:TޮޡީWG#ջR/VǨcկZtz:O+JC~]RV7ՇoՇZu:M~GvAvQvIH}l,bH>": 0#T?QWMF-d{e Q!Eoʼ;~a+-bNocRP` 3g$)&1ż"hoP 0Ʉ̦+҅`^5+f %p_d@&O/e%֒_!v]J|,z/Y;X{gz3M'MͰ{{h0{í+qۖlJϱendf>^W,6+d~ښ19x cKYA:vvd56 &qWl8j{G崙:~Voj }Nt:љQ:Χ h#]HŴ>V K}5}?b`6f:~]e;oֳd?i$O\:H-clDZ[n!BpRK1 zqx0K* sQY+~MxRWOX!//{.'?!"''XALGb@vɿa^ǼRP*iJ*'bB VzNQ֫b\">Ήڇ-E"q=l'gn ]:8Ǥi4Gz\+͓K FiHZ,5IOHi"-Z6]Z.u\2' H#YHŤ ~Y <Ox#nO%󌘭LIȧ峂Y1)`W0P x"|IU눐`q!W$2%µ|cHp=_;q0\'NϦ>f1UbZ Fc,B7YbgZ9qT* iN.׶Bۛiʩ _Alu]mHoٿм}G?˼3y" WΝp(Y_c/& 2}//V:"ؘ~N?Q7^c=lrR&<,78+P.4#,cS> lm'eA٤G#=!н"S%k;}愻߲[]W ҟ܋ hv^~^ ^cؚ~'uUƱv2CV@Wp$֨0~|gkM yµxS/QQwTMMMomn15S7X ax_rH], WM]+;$꿫6u0o|\`.CCqxcoLj/C{p1+.1+N1~k،$$_?V(bP$6CJRQRJV2J6[ʕ*㕯){}97yʇ 練hhFhӯktN ZCIߢô~Nt}6t}Υt ]J-tmm a6wfsad<7n ?^^>>>>>>"jF‘dO_d`dpdX4RLL̊̍,,GVFlll\\JQ5jzh2'/?:0:8:$:<:*ZVG'GFgFMіhG+&>=====bj±dO_l`lplHlxlT,6!VM͉͌-:c66ǶvŎNN..ǥǽp</OWƫS3 xK#__o{'gB”΄?MyDa(Q(OLLLJ$j9Ds5љXXx619#'q q8qq))%3OFd^2?Y,J'%G&$˓UYd{+:.!ٝܒܑIK&'%O&$'/9-Ǚωrrs srsL̩ʙ3=gV9r6tlّӓ/7pα9gr\J)%eMST1ܭ;s={4d i!i:NtQ8=,=2=6=!=)Pzj>=7ݔnIwҫ-topXdL|bo*3D3L^&?S)geFfd3325L}fN1ӜitfVedl̼ٟٚٙٓ9999Ž>y ^~ 2D>@/_qN+2 Z*ʨ: kAsw{{e`C-hh4q@|';D]'r|';I/ïGǗ\/$xG[~mіmі:GbD ʇ? ~ڍ`Lfn6+W_gw!~7΃yȝyȝ uC(Yğ5B] v. vA.^41Mkfmͨ H^%K y $/VK>Ud\2pA2 lC+m(ӆ2mh 6Ƙ#ok9j-G娵WNǐxImW_{e󀊎@.V![EeT Uk70acC,[! iV Uk@^׆2vHp~M\ nQ׍\7! n>^  d%h+h+n3-Q+Za |(Q1uq.[,r p8hV5YDZӲN6qE\b _r6YU(SC?;yݼ _ k% A{:C (pA3/)H7o  zwWt $*@.QCY S7o z,)8VUl˄u|Vk<ن^A l0nQ1q 俆y:b- 0KK܅ A/ѱxxx-֓;p=G^@sm:r~JdYc/VNðxxxxkc^(81DձrC@.Q%ZQuzn}<* @/+ ##Wd5JVmyX[h@'}d 9F9P+GÜc,Gս.x*j@k==͐( tO-O 1/\aei+~=5O2.ǗYS8m,3|1 }{0|(eE6F-CKvCЎ,hGy=݉4Sܥ#"Ze=E9DMѪe|Y|/|sf>z0L B fҽZNGFA.7YvF`Fj.8s:cmqOa~|>}h1 qvaˆQ3g1.FMMiF hݜQoW$Ry,UdFZea>9Ƒp;؊V܊ҭб =m.m.m+Ў5Cr;tӝ;ۉ6-rx+1 +-JK8Sؔ@`o' NUhi dYC[$1; Ȱgh|nG(\xvl,9(邦,B lnH/hG^,lsgg4Dy,3+Y]MBRBx$:B>?bȍ K% c70wud%+`+>\‘. "o`ii.=S&]ĵal;@Mǡ}ǡwzǡwǡq(D$zD$j%Q+ IMuyzzzzzzz*X 4f\ v)h)h)h)h?\hߟ<Ƀ<Ƀ[o>0000000-r#I2`pp9p)`#_;-'t"=]+)=mf=]RQ,еCbhY -_1+A/AJPJз-벾)M\'ˀmEMf a(t Ba(t BTϧ2}>LOe|*S%~ЯUBJW *_%~ЯDo+!R׵R׵R׵R׵R׵R׵R׵q`}fq`}tBЇ* WA*h_w5W|5WըUZըU ը[] VYZgjz?^'ˀmE@G 5лz@]kv6k+м}A_jܿܿZPjB-dBv-dBB-$LA)(3 4ԝӠ4=w9p)`5MA:H:H:H:H:H:HXNGu=Q~{Tߣ:C+>B=mV=mzڡzp ư l.v;Y%,=mv=]zکVj=ZGh֣zZ[^-zڪzXO;SO6fڌVj3ZmFh.Ó'_eVvOW!wN2\ z-U<~9wsZ.O_ruoG3<2_"8\W_ y@Ќ\NV 6.pMH6y1nDQٯ&q֧N:qٟ5"DŽ3bXIV" JJkZwϺ\}1)W_??Wޟ\}?ҫ/֗p)'X?뢖/6JW_p}?k_>wu\5KxŠGP$ Ø lnVSXVg‹Va'[ (ULMX_8G4>i *V*7+էMy){KcI]_ęuG+Ad1yHD8^`' d h@^&)<2"=Fa4i c4i ?#7љc oi owaFMfrՍG4y$ f0*i0+'uoK i4yIdq1' -FH6_Ez<ߤȎ@'d:y QO O O#, O/\ Q}0)^q҆xmh~go h~8^#aM41Ci=k!<Gg~'PH">7O q$c3D"<2>y$3J"$c3P"0g !_ !bCB/|1!_ !bC8Ex\xAi(£3"sYkٳgZۄ@ %ὼr8yqJ # dq?u@r# H @N#ݞ@  $<9`Px#}lH5W zLKEm\ 6)#wN agXQeNE'pꌴ/xje M[kQbR2kf' `=,A:V)ꔪh,ժ\b8~3/'-yF\ҰFmE+iZq!ᎣA!6qYQ{O=; Y!ư0:0Re"2pV ],˔ hN{<@.Uzw1韏7*丞^"׀!A#Gz9p`_o[ڙ5,f8LMCG#-]&%+<z%^>3JY,lq$LM!o>n`)b|X|̛FuRs|i &^06=gJOl Ҭ1ɭx%a|X.^;mwoKaϲT9:q㱣=48trҦN$\w',PBԱ%\ZfwnQ_DQYKQ/>]XeSf`4<)OA/6& s3ce),dܜG30iITԤ4Sf6 ]t߲T{pa\' ~އafե 7ot;,Ne]!;q5ϻǼ^@*|Dg t,m+hj#ȶZ+]!-pnf@SR3@y_ΩskXCo$_Icv>~Nq3-&&ְ^"wyue(}XLg<} y3 #9 zPk3{A~yUtPEd2QWUGU*8*0U%A8r  <! t/6W<`HH mCBmD;wC?Dty`LhFaTG.\yġF2dG/( ˿vlYjgSgw$l1:T: SS|ި4:{yX~DlAe:+ӷ0o5^jx>@>dGH BԃSk~*2+àё$ iMM^ xy}…31_Z<{j E,_B"_Y'}8}XN۴Ad*`yȠ_u44P4/:x?@u.1gnm{Wۤmc'捁NItq1ئ+3A׏w='zk}[^Iy~aG~~OFm-2 EwFk}qzoetB 7]ţa 6 - ࡃj1֊.ޘ㣪WVnI}+sga58PTXIA׈xLX=qbJ=,4 J”F]i^VL:B_YE!XH 1}EFPV\ț\n Pd"&e&Сe;By'F'#hrzZUv[ t%fo|k%Χp\gHҺ*r)<97U7݋jq%ZGѹ5[ $r;$/ȕۖw0qļBM=䱹:Udh=:z33|{ڙ[ܫgǾ:އoҭǧ*C>M6GnjyBN9A3&\Q8%s^Iߗ劧R#B·H3(O䎶HjK@26pɈeSq:a'VM͊zyeIh^yz_7˩o@; Cza{!2};Sb_9sQJ_F"? `g^5R]z/ws Sm\Z~Uh݂`"Q/Kn`#=S`8n3=^sDi{-2ЈY /w~>j$ }1A*#/9">@z$-]D^&1ގ>QD02V@XYvn3N9Z=*zJT:_p5^ 7Xnn='urD@VCPb"Ȗ19ZmL0H*4HS0($-woG]E۴y٘萬~XV>_#P޸tKϟqNG-7=Št V<!AGq2D A wސmP"FUKp*3D+EȈk\ΈuF[Ya8Q3. ۷ùn" Jȯ-[LgS鲵?n_}?ReJ?0D.K%9z}S|ھDܘ;IAe:h5Ur}sjI](Wi1&Pa[= c]x0X + ,ߎ}; `yUR T5GN >I4+b$L@'Z$~!g3^?VD17l_DoǞ36 HZ- 5\f)7;';߀6lS(P]4 BP]wp\ W3qٖ/+(g/(n7D-/Fz^']-qz`z猷}`I־kŢJTԒ䱺sr]ttrIZˡI?|fKCf)>ai1q8ZL-{ endstream endobj 97 0 obj [ 0[ 658] 3[ 220 652 651] 9[ 551 646] 16[ 846] 18[ 695 614] 89[ 695] 111[ 676] 131[ 535] 133[ 469 597 531] 137[ 520 597 314] 141[ 592 308 890 604 569] 148[ 461 459 365] 152[ 531] 156[ 479] 173[ 469] 199[ 314] 231[ 459] 486[ 337] 495[ 235] 822[ 422] 882[ 592 592 592] 887[ 592 592] ] endobj 98 0 obj [ 220 0 0 0 0 0 0 0 0 0 0 0 0 337 0 0 592 592 592 0 0 592 592 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 695 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 535 0 469 0 0 0 0 0 0 0 592] endobj 99 0 obj [ 226] endobj 100 0 obj <> stream x|`TU9wzIf&d&0I @iP$I3DQ(k2 ŲZVvUlkY'Vos>3sS{S a1‡9++X^pA컶3vBcʪCm}e,I^PU0rƸR-˰I{W;.kƦĘ/}Yݝ,~;Z5xOKØ9lx+~*'4s542k c[;|I-Dڼ-33Pѳg~Į}G.n+K_jh~Ccw}/ nμZҗ˥}K!U.Lϖ"ĭSsbp65Ď"/SCjӣiI}Ň<{?|[fa[:j ϛ;ge3M=fI%'/Mw916l2:徊Z9]gfSҾ !ڈ Sőe"rZL>%*駒)OaSF>9lOUCo+ȑj}A"#529kH2f-y. u9S*I$fQe" Uy22jT+UۊK#&-E-p9}NVWko5肨ԫ+qFF"#׿."}e\x
B|&ħB|"B|$~!>!"B'ğxWwx[? G! M!u!^BN B"B$ċB B<'ijB<#B<%įxR'x\DŽ+/xTGxXxP_W{n!N![q q S[YQ^ q;ZW q ]˄TKXP q q Ms8[^!L! q !=\{8pqűc.=\{8pqűc.=\{x.?\8pq.?\8pq.?\8pq.?\8pqűc.N;\v8pqi^[85GӧzqfARh$fJL)nmM&꡼0xb4mN j!j&j"jBj '# $ZAqDˉUK(@h1"D #K4hv3 4hf3TITG=sAeDD3(o:MzS!B%'M%DD&ƊQ+cRcDT/h4Q.(D9D#l,j3G4 (((CMJ&J,%%MOaDqD.s9KCd<Byf"1d&/td(ʼnJ|_-Q 7D(kJ+/&-}MR}J }L}HyGgw;zREy zoN([Wǂ~M\ 5+d|%^"=Gg!z)*+'D%%|R=L=H'^{ݔN=D @hr.DFt+N[ دMD7R D]G k!At55vs+) ˉ]F.%D]DyR+?#':\mDPɳ)KtљD[Έӣ:iD[FЩDD1?9Doz'@Z5DzDtU?3uPcTh D-T4!ǹϢLJ2VD7ʣ[AeA͠Ѹ t"?481uՀ&MQBTuU&F]ՠ Q2x+"uc.cQ6 z=a4Q.56h$5C4((+RI6SԘLxҩ^Q*((9<u%F+A DnxaDqTEdt٩JZh!2T@%dIDu^z!G 7kW y" 1 }'6'>xx~6f՘1߀}%&21,lĴy~ WOƜ}"xL&^%{x<χ'zwyw{﵇}ݰ܉= [D;l뼷{omji ޖ ZԹö{5U?m]`]ηg]=f{F,ib^=59ṕvn 6rF9Oڸsk v ݹ&zgO@}w^%{tp+н+vmt'GX <˓^oqVt7N[-MM@hgC., ,>>b㊗\)K;\XP/YHz>I']H|>'GWgs+}KBiecƫ}ˮpuK^7g\t;%;@qG7VR>bu1+1I%c`QZa_aڤ4M+ +˜3({'w{+T30ϟgX<'bY<όdU)E"3#,ly.ϭ9}66'VUّV3'¯VrWttWcEw8WA(\ŨtV5rbݸš-/C;v1 > -)fd`k5j@'m@+ 8h& @=PZ`%88X,jjX`)Ub`Xs9l`0*r (f?0 L&LE8`,0( |  @0L 2@ x H À88 vX `L08l8_> || || |>>xxxG`M u5~  <<< << < xxxx xxxxxx( w;[_;WWہˀKK ۀs^,L`+pp:kcsϱ9?Xcsϱ9?Xcs`8=c8=c8=c8=c8=c8=c8=c8=csϱ9>Xkcs}ϱ9ȯځrC+c#6>mckmv,ab +oֿ캻 cl>C˅H ˇ-΁}ဳǬj%X  JZ Pk|j"-gDZY- 2X+kcjyMlDj%Ja7QRbaVRJމjcIlۨ}Q-^M612SU%,[itVv&;{Sg ^v6;|.;;#R㾀 "v1]yq(륪rvsFɻUgw.5EDĥQa'b=2cߚhmBߕj=] Cj⨔܂ ƣ"q>@p(u֡Q>ǕC"sRҗc^O%ժjj5 vcqMX۷V܇PE|;MŢl7ۃT}}fZa0Cdcy<CujH+(8{;Si {=sH^b/Wy ԋ}|_Y%:fb%lϖbO`wy򖘌׿z)i\xޞim8N; ?`?/xcߛ>*)}c +å">V2⍾ƍ;U_+ ƍMt2UR\e&ߴ )AJM˛Z5%?ͤ3u)gsZˇJs'řqi 4kb)շ~s8iˬfIo4'%1kcSot%Mq.{Nqp*m֡y[s)VvjT)07n'dCmW6%?=snMBqӡ|ՊR$ދ:d$XEĘ1Fo"o .`iK\Wr/qA*9`8׸1g| .en}r7ȖHN`k7Q3Z2teЦ4M:јХ1wC>=y#2<7Ȫ\l.-!lh þqz\IsXWIɘ¡7OpBarbgr0 -)NNNƙZ3z>֞12193d3Э9xݮ3Z >1\V"~Hz2}TM{JucaVɽg3U|=Շ;Rs]NXܐT]%C?pG20netCJ;+Փ:2 5*#ތAK=}yac&J3\ cApʌ%),19RS3s*s2{Y=1 ZTt/^ӛ UrQ/b|FxeZcٻ0ͱ~{u;޸mGlK~=Qқ frʾMFef$\+)d0lI9i7m⻔dUI4D&qu f#Y읆,b 4:^[wa!u.υc<e+Unw'X{zkHP&ߤ-UF/9UaoTRho~N;Th}[ Z j<5ڷڮB3[˯ǬQc0d V#%i| iuzWZ!u' 6݈"#r̂l[6aǘ^+{3Ӿ=t;2ښ_PMjCh5/ ս8PҦ2:)s;Q>-֩kDVZkva+>_5h-(}ݐ 39;:=} #mWW:vw }=FDFB]GF'\khrt:nuބԷKH{{R6=NGlư\ t[[-Mnyq;Ե:Ԑ_lmj[j2[`[K:yMKY 䮎nEá6lo;C] {BrW(*rw[;*m=N4BPXm[ߊhc 営`}XniJ?ȭ-xVG\Ҥ6L ֆQeU(_ֺ9[n {y;܌]AF`ө<-6ݲjKAyM9B]CM=$=I:% }chE#Ǻ `*ClVÂ[¨_;=ǎֺuhӊXF[qc]2(jp)•El H,Ja &$!Ȓ~i(>O8w콏"`Br|:]};=nؐ}v{ڹӽ}:lȃ;l v1bD.<8밇?wH~wg}6ȇf~~_<YF?ulY!27>y|CsD8a6v_3{!;ax̯U^||>P气VACt;O}3޹k.d>6g_]:?W>\vG^vsuL02E3Kҩ>91}`G =kxV~Nrheoz~a yOSzLwӐ9X~f֩>f8A9R1ӥӕ;3_4Td/a%ӧs#]+QI]s_ t:x;>Wqm7^u'>ߏ>KG޺3xwxqǏ?1ǞA?]?xTǍ𯼒_<Wb7C2?:Gu;gQG"3"3 kLynM:~' {>8i;O2ϷsLu8>y33|L8o9sosaᅅM<yg\~\z_xnt/k<=?=$qW,=\gd>ϓ?uWf\=ţz3G~;wGNG /tǏ2?{Ǐ~ǯy|x'xF>1g78uO$X#N=6K9cv'֍|5O䁧&=۞w:hҰNnu/~ƗZ6Ӵ;=1mܴ)L{cZ?M`Oiy/~ۧN_7}nj3f7xq;3™gμu椼.WF^cއ.5r̾y~evĜ>9?9+{4f -xłw v|^җ /-UJarn07Ν3w׼6oɼqtKp N4|3q.\M5סz7f½A܇~]A܏01b0 C04=7^<?xb4`&c (\|anoc* ؂:#؃H IE?) -ؗ{zuЊhC;OO>A|ӳΚ阉 2 10EXW;,",ƫXb,śڬu(zTk#צ߈58>r[/K"wz{C-.8: 18_q 8'*,*,*,*,*,*kڥv]*kڥv]*kڥvw.F=x<<\DU8 1b.a>>WqUWqUWqUWqUWqUWqU;ЀFļo7`_^4FШU@cpOoQ[TUEl:*#+%2Wpޝ5Sp*oNOoGt·}~33Y~.np>_q.E1.%r??U9q5=p܌[p+za<40=S iKH[BҖ%-!m iKH[BҖ%-!m iKH[BҖ%-!m iKHۦa5PHo=JX(aJX(aJX(a!nM7㼙o&x3t5wεܹ;rZi %PZ)CeaXz|쓏}O>G|lU>VHGR>򑔏W>^+{c|앏7XaWvd58 mYmVWUo_gH [x+opV8 [x+ofYom[fk%=nLBrg:ؘcczln%~;3L)3vؙ;S`g L)K֩un[֩uoELtLafcQQC>ì)Y9Yw̺'vֽײh1<'1xOi<_a,KoϚI)x/{^ґVI HG-m-m---++$?t:N9t:N砓|d>r29I"iH$&I"GF}QiG>ofOuXqov6f;lglmv6ۭ5. PC)wXEXWXXrG)}TC#'HCȝ]ٺfNY'7*}|w|w|Ҩ;Gkuֵ:ZuκVg]Ykuֵ:DDAY\ \p#=v#7YűVpld@06xpz$7y28=x?QPPPPP5qkְǭa[CƆ VhvۭflVj{Zѷwۻ].}{ݠo7 v`"v+o7 vݠo7 vݠo7 vݠo7pE;WsE;WsE;WsE;WsE;WsE^s<}k!>긁+++R,R,R,R,R,R,}};zNo޷S۩v};[+[[[[[?dvFowr>'sr-Nɵ8'B:N/s=XbC~!V?LMu:SSdwnݭuvNO+J;+DHىHىHىۉۉ>s `Tgngzۙvmgzۙvq 8'o٩٩٩ղZvVjYmv1*Ckdh 52FZ#Ckdh 6j6j6j !dngvngv<.;dC;d"a:f`&0 1(((,",ƫXb,E ^2,NJ}|J𺟿U(EoʰkP΢oc* ؂u~zlûخv`'v'sdN 9a2'Lɜ0&sdNj_S%DՖU[jڝvݩjwڝ揁?????Y=~qnM~͸ ~7vCznnnnnnnqqqqqqnfnnnnffffffffnιnιnιnιnιnιnιnιnιnιnιQEQEQEBg|g|7A1A1A1A13tܜ%=$}#iGfYw4][K#w4 'T1OT1OT1OT1OT1OT16c:oooooO>׭:͗|Y,_u:WUg-qRz_|8߹5b0'{n=|w{nVkVkVk _ґV:JGZH+i#tґV:w=fLs3yn&1f s3zv/뱀[s xn-<[z,zso[<Ͻso\-\-\-\-\-\J}z 5&p]kwM 5&pKw]/qKw]/qKw箩5rT]Sk*wM宩5st]ӹk:w5s|)w]]ù 󹫒****k>wUrW%wUrW%wrW!wrW!wrW!wrW!wUrW%wUrW%wUrW%wUrW%wUrW%wUv~Oi;?m秅B27K 4࢛ ޅp"NJ?W0 IVHB0Bd$+$Y! IVHBSPf|2=ƲXV cYa,+e0ƲBYYYRb+X! )VHBRb+X! ŬP ŬP Ŭb+X! )VHBRb+X! ?y^c+X! )VHBRb+X! )VHBYYYYYYRbbVHBRbFVhdFVhdFVhL~⦟'n~lQAv3n +d` AV0 Y +d`% A0Y Kd ,a% A3H 0H 0H 0H 0H 0zY d=g A3rY _e3  ],)c3H1H1H1H`2Y e R e R d,ce A12Y e R e R e R e R e R eߑ` ` `3X^81Ndb^P k~ԯRVJ}TRg 2 10EXW;,",ƫXb,EIǟ嗛77777-sܢ:-7÷EY[~V?}Ooӷ[~V?} ^WU*x ^WU*x ^WUss*T%R\KUrJ.Uɥ*T% 9oI7408<9I,` R0XaQ=,EâzXTaQ=,E䌐3BrFH=,EâzXTaQ=,Eâz؋z؋zXTaQ=,EâzXTaQ=,ER:BJGH)!#tR:BJGaQ=,*#âzXTz7Oz7Oz7OzZzwnһYz7Kf,wnһRzJB]( w~6K7Kf ,%x.K~6J?FgQ(l~6J?r,G?r,G?rV Ya + d0@V Ya`guƙ8 ?] #sqGw+.?Ÿ2\৸Wg ?G65סz=܈f܂[ wwgdݕ^vwwwow/wdg!?1 bt/eח__~}ٯ/eWÀ9zw;G{zxw;>Ez*sNtDfa6 xy",+bU,A1y ˰+ B)xSMe? ƾ$F6ʰQELw1-byhp e&[ē,l1&>Hqa$n^f̼3~fy?3g̼rg8+Y9Cl`'8 6Nqla8F`$F;sgEp ?*VʤU&2iILZe*VʤU&2Ă؃}*@zW~+?z? nD G~{+ʧzqڃ^ĿGappppppA hE.tѠdhA_#2hVB#&X kZ:mF6:сlt_ʡuo61lݎtC=vJ4;gcl'/}&Mٿ)7eߔ}UWѮcWUAO#4WvS"iH;E)Nv?GR|ٷ[i7+&dZ1bhЊC+V Z: au@_G:ѿN R_G:ѿu_G:ѿu*+*kg鴳tY:,vN;Kig鴳tY:)D%(F6JUvHH<O ġ<֩k[AD[6;arl l l֊w9}'c[jV;ڱՎvlc[jV;=Oߓ1CzCaV܊[s+vnCN^m^rZh?^O7GWϹt"n_­pw0ԷiB픱HdH=}D'>.o4TCg]#dN2Z:R{|J1Ye0Ye0Ye0Ye0Yehy9h.t4rX+VA5 AOt 1PC014Roh m m %1PCI 폡=14^U*xNЉTGKi ƨ1c:ƨ1c:ƨ1Wf - C0-┈S"N8%WH4+Q:i:|'ipPfyp`p*-SL2E-SL2E-SLѱtc?O~:ӱt_?O~ӯ~_?O~WfHc#]ծޑb"D!i7HA k_=P<+̳2<+̳2<+,ȾO}}d' /Ⱦ s0 X(` X(` X(` γXb!X0.~m;eQ.5 }0g")")")")")~~~~~~~~~~~~~~~˾3qz%~,8Wvt3Pw:xS43&z3|-Ke^e^e^e^e^oBmVo5{ʵ3,2,2,2,2,r#7p7p7pp؆6͊s8xR|uqX: M8\-Opw=qUóp'*˻ey7'p1]Z.2.2.2.2.3݉⽝v t(s/}J'~_]!e(x}D3e:S3e:S3e:S3d:C3d:C3vzlΖlΖlΖlΖlΖlΖw; åモѷeaٔεߖ鲘$I$I$I$I$I4~hLdLd1VlLeR/zˤ^&2ILeR/zˤ^&dM&dM&doNVE+跖~'WΦ^9+d|;n{ӹ{ ab&01L `b߂,` -XhyzB ZЂ,` -XhB ZЂ,Cn>CzCce{L Tu#H8G1p,`I8Nd8>ii y8΂ _7Q <Gx:x i< i^3g ,(e"-ڪReze9 0`9 0`9 0`9 0`9 0`9 0`9 0`9 0`9 0`9 0`鳈 0X` 0X` 0X` 0X` 0X` 0X` 0X`E 1X`܂-܂-Ra9vҝC_hy1hy1hy1hy1hy1hy1hy1hy1hy1hy1[V` T5&Ƈ0>!a|CƇ0>!a|CƇ0>!a|CaE1^xEwa ]*(#*&8TnP0F~ 73UsU*\UiKTTu|j?{}~*VqUhG8Z*VqV7Z] }/hYՇUa |Cp(| V/E ·/p.&D4jQ3iLf5ӨF4jQ30()NquS\W^j^Wa,^K;kBD?k+gZ{g 3 ' ]Txv>.NNNNNNNNNNNIsJqJqJqJqJa=4XOc= 3X`= 3X`= 3X`=`zERHI"W$^+zERHI"W$^+zERHI"W$^+zE#1y̏12 >\6la mlf6۰ن6lak`yl汙fyl汙fyl櫾|2\ \ 0|#ngL `xpJ yxǧ/|*wߔoP+ʟ;+x8Jo7G鍣Qz(q8Joenj3yyyyy]#1呣mh#G9F6rmSh-Ƶc2G&\kxmm 6^kxmmF^kF^kF^kF^kF^k%6<^kxmy6ZWKj _-᫹|5\Wsj._嫹|5\Z_fˬ~/eVY"wE+]|W"wE+]|W"wE+]|W"U^C灂@yE|!FC 1b4h!FC 1b4h!FC 1b4h!FC 1b4h!FC 1b4ho 1b4h!FC 1b4h!FC 1b4h!FC 1y|"{dڍnvcXm ~CP=TjU{C8]>Q՞Q՞Q՞Q՞Q홪Tp h8pp<|> 'p T8 > O98>gYp6_spMPS7O&~? ~ ŽAҍt!hH7ҍt!h7:oAx~< u< xO0f3g ,o/^Wa,".MS*:E\UvWܕ4w+]iJsWܕ we+]pW2ܕ we*=qWrܕw+]9qWjjjjjjjjjjjjjjjjjjjjrܕw+\TsW5wUsW5wUsW5wUsW5wUsW5wUsW5wUsW5wUsW5wUsW5wUsW5wUsW5wUsW5wUsWu]#kw5]ܕ>>>蔙巟.%aY@c'Eg+Ή?7z5~{K߈Z̨fB6;6ꋍOipfeF/ᤍF7j}Wg\quzFd;%~wp[=jNO0`dQRtEQ\V^ەhqeD\Dc|%oP|JF{yb(b5[c~p{Js_i4=hR̭n_`7 WtLC 3}L_R3}պKcg _4+ݼ#*H1*Hqi^3}LӠٖf[bo[fe{C3mpn4uF-0bkX늽]g{bc 6Į]wF[E|/=Hy/wsaިr}XΧԺԡmh`5w)!g 2vۍnl#DsWx,}`ߗG\\Kĵ$veA-1݊٢ޯj~~'u帿og1WV>FyQSzzg{>NV?ƮnIQ.v?P1nMAnuG21Lcf3MFW ]{| ^kZ+ ?c73?vK4#v^)p4ZsjQntjWuƦF=1Ӑ2lmV(eɡE-ha ,7E9Q(|\5OĽ\bΤ9{B6j@ddAzoXoYoslrX&-2iILZpҀEbiKspRVJYi^Z mVB 9+䬐(qδJ*?{zk^+Z)kyjVZjr;f4fm6SLzch[0{+te ?O⁊5*cTF}u&]Z.ie93"#k2ɔ+u|fyQEO4-ֽw]55H~o1p-&.M"aynޠQG(S`cEo`/?7nQ{ZZκ:kRul7X]}ڸ`rp8N}c/F+ce|ElF7D-eOb+&4{\ y,o-(DwŊ !تވ~70F~?Q`;h^8'GٷOG_|XX=ܦ+5Z#AY bkleY6{\ DWa}zvǯ,?^R':;cotF+:y7Z܍nvFn0䗍晍<ki m& m&o&YL2)ˤ,2h,du)Q-m >gE^7YD^׊RGkEo>$6IKE-6v1%&Q6n#MnUk*uNDNkJu&ڦ0-r-QTuRDEMR4MhEӉ2ת̵:|*eu,Һss{: T+(íj#T!{, 04&Ӣ,}b˥=;(U<r4]O\f׬hFzΎ>G(}j]m_Aq?6zSx^x^fܮS\k)C&,lczV\ʾrN.bh \ !#'';ƷNFM|IW.r"yotS&-FL3bstSJ.C #YMZn B!Z窔R5_AW6!y[܅lm:vhQ=p] וwREUr^f4à+w|R ~{*t;qfjs>57K,fY^0K)V;s+[s?u[=[/M#ʁN-95vۃLKˍs/jW˘gі=o ˔\e֍fv3{+2x[ȿ9` FvuRd;ň>޿=lfcW孔6.o\\,’jm6XDժ_T]g+˯ǕF?SwUy}blշVWykї-Z$;JeGR:wN3Kfl*[|-ѫFenDֈ,b.-'`~iwr+oᷯYQќC`w^9K`m'[gc=V88Y7 W\=ꜫsr+*w}CUhqUa7a  ?>у_ׯ[af90u}[J`K->jp_Yap8 1XN:x;>S-;̞UN XȼEOȃhUΌLlWD}1ɮ> {;_~`C`gqp5Jҳ+==V'ݳR[] sbϰ)œ DW}ߋ?'s=o2/HV.Q?QOٛ"[wh;L̴Lf4ӰTjefZLe:c:]<}08r߽.2'̷|̗76j找{LkpppF-&z87O` R0Pζm:l7#H8W:ca,`<O p"'))8NOgt,|΀Ùp \"WU͏^z9] `!,^ZK0{G+}a?p$_sp| ·/p\ ߈7?~\ ?Gp 7¡=)p/S1x$2hVB#wljX h&gyf7A0[AA^nP0Fhx ߈n x*<\p ~lZ\ ~L_-Kn ^dt̮2Wfd6Mfd6Mfӂao&n&n&T&j-<aGa<OŸ)x x 3Y5ǎuO=ipftC,wn}{ܙGUdT d%!!싨l2(APDULC #8(2(k@Pm$ k ﭴoy.{?N[:t&g8d6I, f41EۈܻNˈ}A6~eGcXv4eGcYX#_qÔbR SaJ1L))0ÔbReϮNS&)&rf |` p )xj ^5GƣzQxTo<*ƣh<*ƣh<*u),pR8X K`),x_ޗ+b%\p.VJX +b%\p۹౷౷ώ~^w/K%xxxxx1;@1;@1;@1;@1;@1;@1;@1;@1;@1;@ITp->rYYYYYYYYYYhS` r3͑NY`t?2FX0zfvL񐙆b_3K-!`#fR|I.S\?H4\';P"@ PD( b@,@{! .0RIÛ.r4*0i:n⼜#w`^*s0 ] ||A6` A2@@9N:߉GQp 'A8#-CP~(@? C>u@]DP4I }Q5r_UA*hf9hZVwk@PׁCK_5RUv5Z.Uc+׫*5  f9`.{ݬ Gcqx{w ܝ:+dR}@w0, KvrYZL~_u/r*wykvr%2=}h|<SINHjHA qm˃!0$\ CfY0$\ CraH. Ʌ!0$\CaH0 \?l3̦?l{?O{?O{?O{@?V+Џ #=~b'=~b'=~b'YXb'=~b'=~b'=~bg3X V;`3X V;`3X V; =~V='=~b].ff مlr/&!!!! m!|!|!|!|guU,;za8G%bWgW$W|}RE%PzId.Iļ$^YJ/ }KlIXIXIXIXIXIXIm@[pHEEEEEEEEEEEQ{.FQ{A^DQ{A^DQ{A^w1jojojojojoBƶAAAAARP|)(_ /ŗKARA9މGģw;x)םP}cxL 1<&cxLO #xTTTTTTTTTTT2o[-J o鄷t[:-D&Q Ā8w8UZj@Qa|TX>*, GQa|TX>*, GQa|TX>*, G33333333333~B%F%$v%**2/NJl"J,%TbkR_/ߣ\ ֻGc]?w@E#=θLěŦ:R'9Mނ&N-Rf!NBJ΄nc8e0~-p*D&Q ĀXjxw5i i 2NeN8q:-tZ鴌i2Nebܯrrrrrrrrr yP<(H$ Y,Ar 9K%H$g Y,Ar vr&Ml'7Nnd;2e P*#U؅ *s,GpkTĜvk^sM7!np{95ݚNd*qNLh;q\M8"9x """"""""""] av1.Ɩ;1~*`p 0V. aVn/;"|' 0g(9߾5fgހa*fV0t6kuWuH?g6Þ-l:P:W0D]\-m[?hw]Ӈ{7Rkjjڝ+\wƻO9(^vK zڟ֧n 9j35b^ vM1uNN@͕Ox9׸ArC 'q:ūO@:@:@:@:@:@:@:@:- AR !|i5ZUq^ >tAdٌm#cqRGmfjg%f?\>CwA̭.t1角hK:ݤ&ٍ҈'OgV>[RS=3Q$(lv~mS= xy+fV| c/QTῃ:=f?ɖ$bD5xOVd}YiWr)ऴBABABABAh 3r$tTs}}LYMfv݆' qG`c̚üOҧE-ɌcW$f{͗RzO2H2H扮ԮM{oqO ,Oϰo5D]ҔHp>F1g/!q i?Lco#aq[ik+hZe͝b?=Lv|0ajV} ԮikfR{~rrЭ]d?_w1Ĺ]nv 3!c/پOi>YM+m6xII ;O23 fYқVi]sG?o?zZlOO6eܟ [VH!w7se3Wffg"rCvγ!j+}=" 9*IZwT?YE!#‰f1\n;|-E!Z ъkwy}Ӈx:.O NaO7>fPvU<#Ĺg.ZkFk%v̉r b܀+ɄƔ$#hBy}8o6j6Rc/y+ULR1mqy>쏭k??bگ\;;s7m:K-'AzD;ɴ֐gR87Fk̽kkɽVIMl: V:?ғV#7z7z znUqi;\H#WوiƧyI~Дͩӂk-sE+AP;I5Y"­xO7C4^sU?o%2\)u7/7~*r9Zp%[1?fԣD m!rR˳s#4N*iFiIV.>um [#q0XMyܮ Ɛb]c^{g켫8'Kܯ j/5p|1'@dKTK%9 cȹHVӀIn;VdUZ8ޘziSZR^zEw2Pu86Ut%W+ CU+"i覶r1_\+:7uJ7$K [%BYӲ^3 ~[zV5T jΕoժ*a*RPcUWSU]5]-TIS|]᫻zUzjJuG;?:MtOח}Lݨ}PWU#u}ӃX}QM#uǩz2D=YT}om>5O?S ~Iӹcޠ:w z>C[NWI}Z}]#jƨ2Sĩ=&QߘD3Mcu41M ܴPL+FUv\Z֦f.5MSGE:2tmz8dZf2CMc&T3ܦ;͝ef61nkyǼ5+ }YiMR]mWs"Zz֣N}_ܩ1wLI„2eoTdy%+#k[WCJ{[3td ڸRnQ2!\/="M] s_*n[li& Ҏ~J|UdL2Jx{Y~i.?HH.A ^-Quq̤$I It0rxq#i-}eZ!3ܲ>TIhL%W@A)H'#O&8m^`־dRk߳vݘQl֖Z[fmGƌ6NWyhk#emcLbRmim;k;Zڞc}'^e5c'gM2Y;ddkO5̰vZ}FY7y$Z[le kgTֱmEᴵ]nm/kȚ:vځ]ixk}NvkgMc͝ηakZKMt2>-ibE[ؔ1?k 1# Nm_`%V6~=ˎRz؟ľiGgï~I6glS?ΘDr̒{k#YB/d6;dT1 YJ#R2կz_Up.Se+W֩կMեIn53cᲠ$'.equѹUUZ:K¯˪2u5bKo p7E1oգHf:)Uq̥rs㇮| :>A]S˫kQ(bN5w%V}QR:%Z#t8:FHkK ]Oד:YQtSTtkZ͕C[lo*^RljZ\ԡr7$We,nQrCOkaK]=Cϐz%+\=WVyzҏGe~\?.yd_u#ϚMo&Mffg/io3TӇg6c81&3Q"JMm%jnE nngC.8m,beXF. 75u݁MwNwݝ{WXkXn<}Rgף~y+zMG-"k4vR&NSiᴴ]Uho7j8歮?a8VTNk w8INI4jxS SӉth'ƉuZNS9:+}C=Ѣ;M,17̛# |n0|c*!9l37GQf1-l^f,wyx/]eV<Ƽo>0k͇fYOݦ̔=fg<絾,W+y4oG&+y(ɟj'alI[|\S jNݤzW@C(Pǜ9T> (dlR(EG_KH9eR#{erP*NCDcǙI9%JHH\/0k@=|oCPC0=+LFWO;h#>hSgtSFyJ8&@MG( 0עvafe&[\s3'SfEᾇ-0&l1[M)2̗΅Nw^u.3WQ QdZF f8Qj)a޴2rY{Wee>fY!,O+nN;wuw{O?xso V: 65Ck5\sl4K:Lr %fHWu'QozZwFf=XSGx?3hRΜ/M J88yp6b<˙`_j_ Zë _{Q0ylDWo\]T>,$3EV+t3&6o=]pg?Nԙ[ldA+n/wsMs9m{=ڞ9zT.W[U*Rԗ*bUJUPP_NKVe\Q{>_PUc3 sҜ2M9cBO9,dK촶,ш^1Kmd{E<5]JT/ `jfSZQeޭYsm9z0͖U-G m9镣T[V=m9FrŶzr̖>xY ̍Wycv:aG+ }]jvꅝ.fK>+S:tv$YE/)#zQna [W9rz˖ԛrzۖcU-ǩwl9^=csvVY`gE;쬖YlgիXmkm~ $H׈hZMhJַ+4ڛNXuXS 5t>K'ꆺncVCEz* ?p!{'3D{WH'w/ O endstream endobj 101 0 obj <> stream xSn0> !>ԴKdȁyH%ޝvZdlGfZȚV n*`ضj< Wlvl:k`F5emѲ_T [5^v GXqjh4S?;`6͊Z49SEL0e[1[zj_P֦Kўv׉ B.PsB+B>"ʁ;̸L>\M$'葴$/1k\޿Iާ}$GB3t⠒btS@bixx `O=g,ٽvUBrt5yz_9uxzQ{-DɱFsZR Η+Vv5vjn lCS]o  endstream endobj 102 0 obj <> stream x |T{}L&D @PDM($ %5`ժ`[VkR2Iں. To2 B6ow8sy{ιw<3s$"Jhh]y9͗%K@fSIO$5gႚo1~K,#D V>GG=:-+wFd=kAM~/O ֿ|S(?9oiZvIF"%վ{tID7n]wR$&MZJ dD?/>{ަ/!iWh^yQڿGRh_~t\Y16J_rE'|Wk[ x!|~~+>jyd?KzdeE3acVʖv< oA몶j:5c~1{-yJ +=ڢMw -jHd)OzǚƩ_u2ذj z :A_|,4bZL Z&8jA+ê(IKOE S+l%ieYh5ZYlu]TgjO)Q|TuG+"_z,D|M[J9]I߂ p*OC{r@s5mr[xE4ز)}Z=K3]d>4WC+/cXbSqd?XNN,[P*?qJ 5v8>0ת4͡yMi?#f(c-c~Ww{GSQGws^kq@ >fѱpz@ %P$@ @ b$IW5@:ȫJX6jjI)gC{Y6Τes>=,O+m$zǎ.uE~ }ҋ:I=Q "Њ}in6_3 (3S@ "1"xмnPԣd$Lfd! FV%9uru~A1ƒ G1x@D&qPJ$h T@ AN~J 4$?4Ҡ\'PeQMʄSʣ,Dʆs-o4r-z嫟d*N:&AQ1M" ɵ@gAJ'Tl h LhCiUl AΥ/4JTOSB3J4iT~Hhk-UCOt=k-Bb:M}u -~jgQz:HgBAߣ&6bh }z6]ZNK+sKKwF>NKT_p}nWI_A0З}Cg>G/vz<uC_.ABwrEA_՝2 W;5-tw7)E#7?{iG@ӳз9۴]}p=HCыwK;]~@/ч */\?#1PrބU>?~N_[%Q:UyLxLyLyL?ca~<10yLxLxLwyLwyLwxLwxLC<1xL?cA~<1xLyLyLxLxLc~󘾟}<1}xLc^w cm𘾇=<1}{xLcknbVLmb 1qɺg$Eh?(DAz^7hd2ֽ_ZkN!bt` D5دnHf8&h?`u7=;_3Fp ]D2Ǎ@ FKpr+`F QOH/џ[ X~Fcu`>?[iӛ`0pb0- c=@ ƚdbU~ss+ÀJ[xhz[ȭv> Z' /۹AKx@ȭs֤@ hcO ފ]*7b(d6Lf-VوddRM3,+f[i#U$}15jX%dI xI5j<24zw@ ʭ4:&$TF3r+f 2FV="08XaHr+ݰrWF^kxDVc@ Fgql r+b12- ̭`ВAk5 k VŨ8?3U@,Qܪ`<2;O"&S@ _{vjuapneXfͪ#aQY=b7&Bc3LCbdlOdFum2|F a Kt9W6,~N3AneY;dwXOA `v ʭ'`oVݮ#e[fn؍ȭzIG&d6ޠ׈oT&e^[ yR'Dn5>Ane=`(c=@ &M:%:v;tiu:m=b7[0-:\ F=' +߱ %Up}eN2$#Fp}]DI()@ 6)ȭgHA^nr;n;7k-6< FFfa]pFA>exe7UCr+T m1ŭ ##.ax@ FȭbX#&D1ΤR,W,c#v[YVl8[ PFB^VV8XMqr+]D2c @0Bd0Yb05|QǸNwQda;d6쑼 yU|\u`|+]΋\R/8.[GFpwȘћŸC @ Fi1rC%ĸ8W,˫"v;ϭ#9[YVH&*! ͭ^nes%n7An{b0Kz @ Mp^ h6*11N))RbL히reLq\dܮX$5دI`. FmcXne1'Jrc_( 'v mpXOA `ɮlON6S=ɩI)6JM Ɠ'>)GWgX?.&KlL ,ҳ/*ja0`zRcm%1CzN"&ڱ@ h3qI:Y,b_ןɟ'7)#8=U%-...+U\+^"77,7XQ $mWxVvqzٓddq2zw&.)@ 6͙d:3ʯ"{=N 榧'#==bKK'&X(LHJ$k757$&Q93ظA~̭Dg xdo&16@ F)gxl.Ћ23NdfRz?{WNI,CX'Uߨ߰xa}0ol>%yΚU:4ʦ-*--YEKY{Ğ5o$K8q"yӓ&Mςk7*' X mF7 `yEy)EC228`w9zwXt@ FgNDD"/ҲYST5jRYU=b-?0 O-,,$f2zep췰Oz 0 `UMNJI?ό@  (L[R%94# %QMI4TOP+]HFLR7=MMz>/%4IZ* }J/bEضΣ cn*Hg{ɪ8I}GmtN&:j*JuzQ;nwz!z dyЖ0*mߪ!HfdNɥ hӨ9UsUϧS,pRAļܜ @MMI$%&Ÿ]NfMF^(D_8!TU@#44}h /3ϳyzח}?S|يe*VR"\yrta6ZLya2cьp|C?Y r|Ō VL*(' J9𴺊r_ʚ( s aº; ]~]5X͍KJc=ÙqL_E箲zs|lZLGXV6Wbpk|K.,]}l?>]K4 6IjӢII~Jٞ@}cyrG /+w%/96{dbgKܝ-U/;Q`.NɇOӘLip 78'l,khw@m_?[#-Sb,;`]䄳 /39'^-*>ZcX?#gO!Zz}I,z-3˺^K 6d;+f[z5*"Ƕ6j>Yz 8aMGjnޢu@9 UxaawY{d»gRga}i:~7w 8y ;zsnۊWE)<#'z}fz, &ɐklV_e{C{cnYoUꔺ֊ާ[}ZOz iNmJ;էukmu࿐k:eI.k(Hnʬ5[j N=[CDUzSD&QSmѦi 6euªgnZ.%;$V9H aڠ}(rŁ(XVQ6孮P7꜉U: WyK~2ɋ}qnYZY2g+;p_IK^eM٪k#%V4Hd$FOF)ѕQ y؟S{ٳVg!:|Z5ȫ<<*(~Ser.}x[(ͼ9$w=ϰ ;P3O"c=mhHQiL:JRa(XK`A%|ԅW8\u9+>p#e8]#wi`( oۏҘ/l{ۏp^[m+jܖ%YҍYRxvIa( rNXzfU`UpՄUjLXpfv`vpj jo;{f-󟘿cfUW)(uZw&&N̔`wB7CQ G E#oz Z(KQA^ވo6r]?9hA<ܥ(Pp-= D7v/wn1s[࿘hir&s8 lA(8S9S~ܐuR=]N![pX\oz \CyY3z3w2d I{(kd瓷R +ЋA?v>wy<;oKs;WwGn|b1ӻ3:r 0<-K{;pG[r{ pXTo(X=NiJ0_|2-*`!wFt4OvͦR>ě3|*O}TLziM(WZL4L}>Oӧ1a,`4@nu(}0sJa,dvnZ)®j- Oͩ֫rÆߨ됤;:J?$_y՗^y}}TD|j&J( ]';WC"OB@R·VԅK5:tfؙ$;n!Y2sd.SpŃ`t) J|Iン #󟤥tRWM@E JC W$-:ߌ|ѰiŹr_Gc1M(ںPKygc"X^ߵimYuXUe6U\̛Xlj6֦&>VRza]J둀K6zhK'LG5H-ҰJJ NfO"g=J#&Rʡsfe͚5 m5^p%gPCyĞ5B'w˫/PXfM=]OHJ[>mCږ43,{$T!4e &i5(cAlu6a6rՕQJxgGnJJ ~}'(>f{PXU$SFaA'A)*\8u=u➺Ԟ0u"So%z(|U Br$LI[j) ;ܫrrvk}ޓԶp(omcau/̀Pe>yQyF[(Q;:OR{WOv[ii=I7BB6Xڎ;͈^Jt;NK:D5W^Ʌ~*t0VDe+zT:_|,Wɹ8AZnxڝtHJW; KMHϥ/`BT:V t$MzͤUK=Ƈ&Gw7=}ƌ;i@[I$9eazwNZIUƨ껪JTnbIJZY-f)]^OR6oɗk3!iVхUB6sKGfP)5Zjj-->R-d[L~r8>{ړ܍&ұǥĀ(p59§93L㬜EMfq;=;I KW^+O.ߠ=+II@,B4]£|\G6[/wA"=-@@9_JDݍp+[E|#Ei;KF<`݋6n64ϗuMxLݬ{P!eh3CuCX"%_;JORQ^,"wsD>< yKg@A!hG` \t<.ẋKa ~ CS;퀇`|Q1qYڂw:NSEx,=t%ZA>Nj8|{{Oz>˷3k.[ۦ{F/[ON7a(V[PY\Wѣ"ץbz:[NNrax6rqW/e0ҵr- ?S/ !eXλu'PEZZ8D/Q6 h 9^G7^Fo&34 !*\1t=qo\ 5^.mq HtD'0x' OZF~ Lf9Bӹ'=@lj?%rz46uh""TIغ#gq""}oLri"B{a!OJ0o#YBapr\mL^B֟ %@=I[qLoc!)⣟{u!!#Řg>҆Mqadn|OJMed-y y'?xa:cd,}9^\މ4>,:Cȱ/³ޅ'w %  |Kąqr%+Dɕ.s] C`&KKy$; :^@/ η!std~VC('Smzp78b6^ ^^wZb+DL ] j2Fڱ/Q= yr&:iD!|qxC5dKLCydjGΠ7.n&j]! ُ&8ZSj! ;oV/烧펖 il>hT[mY,3oeF 6Ѧjq`;Yp}dSg4/Q6DUđv5LutZ%#TNa;=ʍ^OͰ;TlHv[6t/s7!R!T'SMjk^#&jYE'f֨Ŀ.U5P=>$^ݪSc"ODU+p5Bzv}N7Ilp1>S`XM9_'զ mmmy=h mS6;3F {:݈ @N cha9 5msJtH}=#45;e(e{uBA O!)OfUwH 0ڨdW2am߳ x6**6E0MNY>Ob@/x](35Ѯk+De {.--*y¤TyasfrbaIpY7>džЏm?|+m/ /^ k;"|l;!?&dAjLnGrA2Nɵ*hB AYENNJB* 7{j`\nh2Ɇ;}*{!8@?Qai=i\YE0(0E,6aϚI 1ݧ[lZ$ >fh_`z@6]N f#G@*r mNdԥӽ1(i)^<->sj256Qsz u8炅Ɔc-_OFҵ2n r[}?M>J%[=IӴ5#ߑ䑔oc[PU˓ϩr=6`Isc7ކ7cޏ-MK>gs\Ji\%0;;y DhcZZ{[}p Y^O'85>vO!ܪv. yyyyJrr+"<&u&\oKw2BI!-Gs1¡)C1.R;>e"BMy5McfJ9snnq1E Lf2USoƾ? t6PS0 Y岡l[wwT8{X]Z!S._?g< LY5 FJPLGs0@w p{7YPUNlG۩ݧ"MmalbHqR|-=S/tO<4P?92PxQ3o%1P%^25j6FK!_Y]D&-:u9#fzˡFBc>+Т'JzR?xzƃpsЬk?V'c o˰θԫ5l2n2b!) G!)-G*[lLRf#Ґ^2BG Gv3Ah u iԎtMFݰ@A0L5pYgקC Y|R_Q.,t4S UTB$Lcb>-Icfl>S* FtЎTr$JO4 _a2=`Pf:1Ǹ }m@K؃~[qqқBj˗(c:RWXQa/6M]+הfVR TcvΎY[{u}]0/uE,*EYMe /l6&,%} |miKץ_67Hd$ѣQHN[ I 9Oռq= $ )!ESd2Ac2'@jZݬׇ 0 ``,C%Ѭ%`@d@ h lӝBkC=t\S__mz`zCghBd8`g&C#fh4jwz02roĥ/Ows^i:LKsA%hO^V*L=/^X:x1[Zޜ;+51䡨N33ԛ ^nV52v]Uu].oUCveU_'6g|]ͷ5MUFY--Tձ{D1OsTP|P[䠞-r0bw:6;1Awsgp L#ZenL-JPB'U}LB`'&n"Y6JqVdVFȧO%kuIN_B&GA8$ isDQĔ7@U@*҂)s&<*!,(,LbW"ɉbˎ:D k,h/?DO[TiN#qx/8P7[g,}^6F0M~կgJLav9ǯ,zW_yח]"ֺ9P|/H:X7a?(_/Pkp D4E4 ODF|fԨ%k 'LW;KqUr$r$2rd\H#GhH2њ$Q  rFQ\h,&=L3 ~dtDGHWd{pXDa'L7.<&G yy6~{bzp݄ pG ΪR,ڷ5 ;J䁴s5F"W'ޡSCO S>C"{ nXR!б̝_q7^8#biۉ$Od- td5U !1$97$5$uؑ2x %^1u{nj\8526rF̨!8P1^Ԁ&懻^)reK #Wk+Յ5,+ 8q\f:~ fUcyz w`-o5YUYn&}MH?ld":4t y>6,o3Uy(Мz9gp?ݡ̻yGMc1OVf9w>ߤVr宦;GZH"s]ĥPBJ^4&$ePzNkX6͂]KvMR[gAdCRJutCMF#)cl&]2dMm&#,-lWPЖ,Oa[%4sWEY#4_~FERVpVCZD" b[<{=-٢լ*,(巽IoDo< SRS)؝C/|ǡ7{ f!咨{gV prv*~Oߌq~#'IxZMTZD 5#kVlGij"XDfj,1F̮QFAOՖT&NGb=,(*pcv4vN= +¶Z^Pk!̾8GdY*WMjB%fMzS"~US]{փ}3LZ4)2zN^G-Trc.XF.wq'`e'8>Y;sONYyӝTuw_$ۂzu6Gh Oo #ZcW._uP~*2T"KEeZ@.n4C aXb@5zT`3z*7Wyd\}P-\;KQnNCXm~ђ"+7m[(.)If__{!P4`ocCm& 6EN^ @L@ūDMZmo  4`ϭÞ`4b0w5o.V:t`,vȬjsvelLA05K'J׿w}Wm=*LЖ(\ZBͣv,=g=Ayx=C]a$z{k!Z\!?ՕoX-H+'&L*oIJ)˒]L|Zd[w%{N1_RF+$EuQRѩQ\u)ES}]>oRfvI2fve轙C.SZ- !bj6\]u[Cf#rʷt԰=DeO!*m{AY]3VT֓ȀM[uIVB':ãЄ!ZNZ͹"a~r'䇞0>w_h(\Xr:鵥{CGVpKYo5?;l`6;5%hSlڢEqcs ܤ؃ T y2b LD| صp-]Z^Y}- '1>|!yOl<@{`ӆrA࣎Z5Ӫ,]5d#$&uV9fvTX,B ]vVCaln"#֔ fbbth۹3+۹Lb0^\sި!ʨQC1viri. Qmk[9r}lMa4 ATɦ:J->qXzg᭡1 4Ds$SM9 iT1z*QW3}r%S#j+( *a>eРuh#bQtW [?q~A&G^t ۸u]CJ+ ^;(]{jz{kX^[CI/Q;6Z"TJMn$~8;7W,:+;ʯZaYa]i v]MU}> N~gNpXrjp!7v^*A%ȣ -UͰ\"̨ D\ 5Oyf5)i=UUTIѪpZS!Ű%Uٙ=z֓ #%J@a =~),$l$Y::+0i}PyhBl3ӣvsڷ?L {3p0iN(WG2ጂDgk,zN ,%Zmں՘3WJZg7E.ZdY,,H<I7ouhk[KNidhE ո6YwsAZy2KTT)r9K֧|͓?}rT>k7`}3.]KWd3Ft﮻pLnEWq=GM`^Gnݴ>L7e1ya[(<{{zzfz=[yHh$iYelFX_HYK"5d6IIɒld#(!!o6BNGB@Y'p$ ꫞M۱߳ZD&^؎ۃCףׇ||% OyCn%Q^RaZ %zYsQ<݊Q,D4`$8g$f$8glÙΠBrhg` =C(w4kR2 a5`#&k'CiID,*"m} =4q uY&G&_>ؙ* 0h J WசΟ6w5=Nۘ/HOڨ;PLq wGɖhKrCtC$NVHSۭ$K,1{# SXN؈m/]Õ7@*p`!FIAPhCG܎`lIrՒ\@Ӆ[aaa v@"8171Y\U!byd&/:j \qᲀY7IlӜ5,jm )E&1"dzTmF#$EjX]}rD$K_M1Nd\W7 H(Ƽ!,q x'<~#Lyy<^ͮ~iSG_{&LX.(d'w|+\\)M=&nM>ٗ/GSJ`x.JR\i+8=4)ߘq0Rss@ߠN5xO1HgpBTORP,x<d d 凜' BO&CXFwcB?׵nBEml㶧 `7d!%Gɹ|O._~*a^Ha)ۺ@~bYq j.K=d{};I+,=pf)JMU 6 R |ݿ9,Uj1Pe[c_*ՈXjzue@ʦe@Ϯ;to(?lk3 s[?uxAt75Ů^@_:h] 9DP͵,HJ"U :7)<&kuC \ZI OJ>K #ՈOɵR!6T(J*i lmtgZ:IGA iUHE&c}>wOWq,s˯g2'䟝p_m Zl ߥ{(rauZȟ4󚥢b egdzJWffg3Cƀ (uέWf+*'s=_!ZU_358m4gD" j͕L4TTPTQh4M= V ! s&PXajH 5u4,s M* L?r J".4^?xq)^nk+&8/dCER Sť4Xۺζ-x'],?܁4ܻ}Oڼ|}mhhȵ[k/]_<6MU6Ĝgㆇ(7C?9p,/"*.AK %IP,mt,1šfݜ.7"zFW Y_L\jXP !! Sh^aW~44IR"n#j'kwRk Mwm5$z̓mj&f3wG3ivGX#•4 z0g8d` oKnRb$Gy3;7 f2f\e)3otW<~qW=:9[$UB2 k*c*ROTW1Iو& r~IMnL$bvbS败dV},PG_;#oJтOVv|kJ/ut0G'GWS-ngg ^4E^ KhX/R^&)je4ezF߽>zćo I,(Nw.NάL!dTWVftXL6xc|vn>uf1G zIxe0 ЉRj-)I奁ׁ cޯ[sSgfF/۵]sy:Ľ*Ják=[{ϟa TV"Or+ҜBJ &'@O*1OT鶇gg 5$]C3Z551D/icb'$v|N L cr sX PՊ4Q|.MqcT; R~2ONB88ǩ<6y`\q*{v.(\FWf0&fxbU2ƃy~96C*FԎPmC:^~TAM=@P/4#)uC^W0a|mrnBMMaLIrϹ{MNp`ҦrE(+q==5[oheuv,2G#%_I_" xBHTśWQIMCn;P83κ cA\8%4Lg!}3e?kZ;㺮͏oرpÎ6{?D}C5X_y;]؏o1^na('dQtJpcy'BZQ4Eɰ2Jh6QKy ~1pOی>px5^C;i$5.?MΉN(O@  <:W;]{\\oX/"),@XPQPmW_GDw_n~7>tAؼ@# g",Nxb}@WLf/X`}CYdjaZĈ便'S\ 0:j `=A1#ºnֵ36g"Jhz9xW1[<5S"iيaPF{~XmOD}H4ⒽjU% DEpp ]A# ݯskfî|VG6k۶KwO]{s/zmvn SsTjy@d] !Ff !A=/TX<(kںG6\Y'W](-:}B~ y|5F>NY9>U IH#ˆDD&f"Hω~md"u?yRTv=`z^iw/W2<¢|vO^x@8`|T~Զ5Ʃ;3t@,5Z8:z.DleF[hLm2&%tSD{5fSidY(TzYe;)[N˴erYM0:Q`%m.ޜ<3K|H]]]UlkV{; zS >3EϢbŁvqvߧZ咳--L[Oy{.p8\c9ᔪPj&z ~(\/Gg氱jfk?9y.Dj}5ek_MM:#N\B-==]A=KL&yżx缴Yk‡D^hjS.j)hav KJ37Fanf̭EI* Q=3hca8c|}MH!0O&wVw3[fC{BǮgZ|'fh6Ms&*NʳhrmkiSzpjo{tl_ݭB=n7>eؚkdc]ƕEH`_!;< ㈅XHH04$"R2"$c2F$Y,@+K\V:;e2^a+[Ģ֎qMo*bk-?VJڂM,xy: L5{(Z$6O\b%ſ,AaH[R$W$"W$bYyHSQ4GHs4Gl?,\i8ͶkRZ$(]xw <߮5)7[\|;о~ph}}v J:d[b!%tHFҡcrR2] zl,ZeɢWE "8-_Y@*"\8;Ngٹ|^"X=eS'EB@/]PRU*7DԄ0\ܟ >>)#aXg~ [[jUGىiňv}a e.Ed½O*:E5s-nxh6lJ{r{T%%WksX!oe#DfbZd8 Hy #ē!IQ!XnTP4+FchVꈏ+Z:rp pdwd 1Oq#,as`m '''k=s :'UqjnyenLWA(5;`zj8hË́4LnyZgXmL|ԃ5VTl:6;;3&H2'A tȎ"VC^+9T* 8oD #=%(4k\/If9hBFmy(hJV敃YŠaR,zWt5K^X{u)¤/y]]x tcggccW]ȇ|9 εȪ 5>&kMc Q+a-3P>#%[=o3 Ɍnbd Fhے0;Yz:(>r($4dd ㋧] )FL%G9_3Jf;̯NV25Y^^Ψ :n+yyӼ# <%oŷSiAm m|;w[^`^Ee]]ڪJ5ܮV+MV!O7j\M+]]RU٨ m)Q6lm ?o|^ct`8^oL6쓂֐%ma- y6`0B5ͷ)_dFL=CB혀EΛ$5D\:D`T…g…\T"B I 5,1يhᐽa_țÂ& Ɛr&mKK^*OSNjKѰ%@le,wAEzd9L^" ҜD)DOKx(H+穜[ 鼆T{e T䉿"ٺ3uYX əKV=0ePi1` dUZ"BJ/IByivh|Jϒ18Na&ݗ*&(l^ӇmZeͷRhXV8D#m߿R(+>ꗄH=t'~B{ZOŸZ77uj!3?K3H*|mn-b,\O+nDb1YoҬъƅ.=X88׼+3 $TdR]J &I oGIl,D9`UBTi|% \%D9.Džxt%E*Ȓ$Cj[xS,{zqul,BuT:sļmă4ψg3y)P:%0'$)3KadRgq^B#ytV2HGܗ]v]3!"e>,YqطV|Kِ[ۃD0Wt݇H1R" b+LFmlP޷uƗ ".quM|{L1HO @PCp๛4hrKE*HzIC z.&#.vƒP/FJS|ɐeFsxo-N %&(!6IC!GPTw4' mi%3EVEcd+ğn g.=^H3TZNd3|zN2y׉]222pWgcq$xN~xA%V4nPSN*CdFtnl|֮;nu}Ι{ւ 派]hM>383+uNdHe|,Ftc=q$)]2 H3bhǡNMX'8$ N&KlH7E@\XQ  }}CD5#g67Y_aĒ0zhP;yaØYt #;γ ,Ǿ#AD`BT:XHmXba)p|g!:=ߣ|L RN--%X:L\\Sچ%A 1%lVJOEn#)<9̲ ޸Lf3?$:3nonof}rS@_MW'z[bmN{]NS|uwt|䮏1=O>zǏ~q>;Zg*tCҝ$[Elvx)I;;T,gU/PL*cg- m)ԉkn+p?T,5ܤT!@$H;;ut ~^)Βׂ/W@2,eх܍S P]b'PkE,4Φj@ӎO>tp֦?ͅ։ EVDyIVy?U2J%#K3)mᚼ9,΋8'mv@_UG p. YOO3D: 3#z&&!<g٥1_BxoQQތ765r_D0 2VW=su}G٠&,):4%?p_O?ߖjTTo9pѐGE[v]vUx!c*:L{zfFs$5z#6F ,dYKX/$ $6&$ M@cqIg!$@Brmv!^5y &{νZzW/r>G;W沫@,5j}̃k?oD[.Sʹ&2]!ޅ>Jzy~C LJOy%:EFMI پ"4C&UJf|fg/2r%;jn 7S.>`<~9X!/,myimd;BLrUN.^M$7BK˫:?&uVjEbBHFj+U)u*Չ~3URו7^'nJG;]6@+א{g.V5-:eҺ}n_Ev𒂀" y!G^ziQ$԰[vE!4EslB_zGC_j ujY*PAzud吕l=s.1!GIT*siO.-Vt]p,(|-U|xl#S·_9|Ef#Ɇ\w$ט42(]' Rq%N n e8Ѡl}͐yPmTi!7YCCdۼ D2nEJ-1zE]ۋ$Ť*ejjjTߌ* CEQjѯ"o*|蝈錌Tl;o*85}kŎJ;gf1['ruggʲ"wTRZ";l+,M }[|+Z&䒧\Gu}4wsOeT!90T{Xv,G{R.WRYU^Cj@6I{3`ݔr{l7[tc̱!:Іx  TT uHw T%Q>zq`yy4i̧* M;拾t,CکY~'*U;JThsaxk, 蜘JlU M8?pف/;ڻ&C{=]Y;,=VvU/A-UUE_UtWDd_J@\Ѹ`MoAV*:sv9P}V{XuPO,h-I;Q,qh!#~mC:6]~T;Î2%U~93gݚML( cvl^25+/<5>˴g߽~3뺆ZmW^V1ž{ݙ酷}v6.tGgwL^h2}aԺ!5Ib .%9w =9 ]a]avx ?)sYPWs+V 5Z?Oy^$:QxVVrT]SJo\}p4 G ;nԈ)4.J bE9v>B44;Wj7 iMڶ`QV,o/*U|BV*څA *|kjnKlS+ vJgg8sa %1zb-j{C:˜FuiRU ʞl|"8T(BSܢZstqܣb4I,?vŢX,HA3j|;,rWzvz)8{="S:UW;(]Ocwfw.W`1g{jh:YW#M,gN6)p K)=DTk‰=}D5/nɞ.h_B?)zh->}ʆV|PUǡ𬦣f3 +'.XV(aK} -BՙbΒ|ijxct(*TFp̿N~r%nv__b uo\Tw_ FsLitK-bEAy|]Y{  67xieD`{Y=fZq~Fs4 5?BwדMc?H7v:zL/[[79~zHK܊+oM9P@YJV0Xd&d0y6c0`hT=ʴ")YLqc=Kx{AvXez3=JoyOX L; T& `1gk{{Y}< g~|P8]oK>OwnJ)"fؚQy|sm}ymS<1YE7V_ yy#F@#١2_͔-u4\-̞^̓yx{qZX=clssf] Qjre6w?D<%:;˃  c/%⠋F9=z4W6gޫ\sx]( 4^o-!u!AmxuG4 ڳ΋횜rܤ-z3M:r}4fԳ$dUT$iyqR#kS+Ur/,Z8#?̬†rBgRbxKK6ñcX^ein~>@-===  =Ԗ9iiXI8V,CʰIR*ff.Y1lN+u9W[-:]Q 31Ts/uQIگZ vH4xE ZZ6aDjض {b'aA<"=VJmc6l\)fZ+-DB #ov㴝:>8yAv9)=樿nvȯIBFtQQ5䑸*jpٯ 錘_N{c17wNcoO:8#vq~_O | q_ f^ndJ"9.8i/e3RQ7d,ʾ#&_BjA/+ cS).)[,{$74Li\jXR(ez3'q(WL}W, Pb#ňǚ:XU B} YӳIKmJsŽKΎz9(-!lh0!}@E ;D/["˚ƕQW1U!V"/sg}1G&pY!GZIJ}͊Ŧddd7͹`ʹ6E22](ꆖg: e)\4qE} 6Y^^2fʋ *^ /$ɲ_1ML}6M߅'w38NjîfbxS[;֍UJοo;qc*[V zs}-6S1y6Z7np1o}v }<{Ij;vpͣ'7{k7= Kˉ,udvM$%OANcE5:u?kпY/֛o跤w߅1tx [wlG8lXm?ݩ^'Q\~Ue~ԫKfxXepv}߭>_' J<.6iuIdi; c$q~OfBa}ZwuEږZ~n-t)ڼڮXvIetp6,6 ¹!z?h|Z9o~E__&j\{럩^Hv&19Ri9b.b'Ї([ER W|"0nbqPE?I:A|q3-3VlZP~_!!pGbTUDŽTL'&ļ #$8ޙlm T.z ϋRuF5ZѕQa,:Dߌ G;u~!4y(;SD Tdl:DX57=AHY=LJ>+α3鐙tə8G&<(q q佃N-;gFFLHYVS<`_x>CUf5nPR=醝i=K%l|07I䉥H.)*!@>HztWυ$|&]-3i$R9r> |mpHΞV^xB2Jp2\'xIya*rCE7ܫ7Fg#+9 ^Z0NVzwB/Ũ[[)ZDړ1.^)rmi=woۃN\rQ/-tCУrXTG4Dɪ\#Ϧu.F>Eo꽳39s^K|Kˉ ^a"d3( ϝSMgIjIʹfVs5: sP5uj@6:2:eO]4MtO T U&U}}kz+}U#ڭN${Ϧ l$U}&%ƁWԨm=3jQy̕&ΜD >Bt{do 8J D{&FjkwodBF;F'-x:1I:֗Uo>uօx?=y`g -.^DU{dž@H/b XHRUS mQKԾ,Z#)s{Y} JKgi"aV0A;ydh;=Q0ݭڗPQ$wrblrB 8}CcjQ^vCGڠuW;FN=OձZ)xP|([Nהּ΢r 5 Ío {VaDw 5ih}ODzY.BI{om[Qtn'IjoUS_99޶|Uu5!7v}jЩP;.w w- n{^Dp EDŀ[oAO1ӆqm& D4Lj :?ᫀo7k!TDjZuv/ࡎ##F&Fn=w/G%&1¯(5h&'hA oRB֑^r^O(\+|N{0GAtm"!>/nN K Ln~)Xd\^m4$_-&?/.4JrHlq[ZMZNYvU/X`k`o;i[C/wC 66%'w?9Ck/8}-f<^|xk,>cst"c3tl~g\ !lб9f\ \,s967fؼ\Nredsslf˱Y96'f|csqWgqvZ.g.¶Uصc"\6s-c)l+]55kۡ咧ق-zZ>kG8c~c~cs~lomeuO:>Gȇ9>>X*Bl+%3ۅv5!x ?< t9!yIЅrp7``Y(~W?I$ɇ ֜، Eq2`ed-J^FkYf"t2nhJ^%x22PW\&N$ ׀1 ';#8o?0ǁyx/d``K`(U#Rd XhzOVa!Ű<O1Bwv$8F`,HxS; j'A +~ b#}*apci1HUc (&ƛNsjZP{)/߁W^Tܕ^ O¿Z5ĩp9.݄iB@LjE'K0<+A 2drF= #>`2KIjKǐvK0V.@_،Y18ev8<rAaVЖGa9.AxGr|HH݊v+yhA.~a)|FS;QPJf،[}<ǀOT7i!v8lݯ Ni;ύǐ\[K{4x0a7ryƹ6Jӆ}o>]PCCE3[A 4oe:]0.B'߂EXv=l{\?[j1 qka}0Tl9rBۑ:tmre60a?<&A^gF: >+>-aFjex)oP]bY>`QY|s 4CY3f ,㯁c`gWVfH{| e78bZFV𠏡%{IZ'!AtfEn쟁8s[<~ ֏ bk`/*O`@&3i DVngOag :{~, 1Z1ڏ?%?f"u V)%k b8/t>E/3ɬJG^Op%ӂ̴Wv!죾m7BU`L +XjtH3vd& }KqG-ǩ e+H7&MC?hSˁ$XcsThfc/߃`?yX8t]gȷU>`) )mINA%ۉ :첫!%ݤtQ+ :I}S-*;ߑ7e/.G?dl|abL,ld` 0i̛d30o3o\&")-L>yNleJlg4테$#)ajZ2u ]-4*VlgZVb`ڙ.bdlabb0Hdnt@g !.@,ȯ&L Y=H/@ȗY"k/ xFǠP^y" oCi"ͼwQ֕֔$ m)mوDk6g\w֕Z|Bƴ&zm\b4%J;Iz.@ 4ٸw泙|M4@ӦPs Hi+hн.?Ғ/Fxixf[;A'Q J "R@S Nvr)^Z-c쉢i(@1MN ~$`wf bb'E!ErHJi.a(@Mhs:E^ܟ} Bj("-L#%cye@sG1Dhnߋ `ͅ9օ||~}[#V R(0Qʤp$`mC͙ o![߉(Y^' bly /|9לBs|Ba۠`mwr{a|!ڷt|Z6~5w~u"7VHC/PDƙȸ!}1?kU_A!eZ7d`h]Ϛsþ<""}G~a_a@x`@_̣YNq t_ӜI!;ms"'m<o=A)vM o<;>&?&$(cv7_,HF>H>[3cA/oGm"L;Q "vTIE-Ԙ1@La'Ob>TwȲ;ߑ^W}yMIE-;/N e5Bi,SgD&{w| 1:@ψy*Yy%U -]sB~_C#H?6JWDV$CF@ {K lPl{$%ԒFAl#rqr d,UY20͇~.Ƽ\' |jONl9flSi 4 )ta ĨbvzD&=`1 DO Db6/geW n}7GsLs2܃ttttt4vmt4-cdL¼v4o7_̀-Q/3n./y7Gk&ִ-N=+=QLA)a|+39\J zߔR0-z:\p&Gk;r.a G89[g9Fq!%*wj~mF[P7]crYN;r# 9q<.[+5E'ݬ>n[8)ug*7cq9ˤ3L;7r,lnrϙ=,8BɒS ,;wB$\oõZM:up}V-wA:=Ntr'St՗֝t6tg99Au+P95v:jq䮭ڝCW ^qv7׃n:}u>v5a">uԹ.vm(g]>zZ]8O+Lpm%&߮u jbH1:9feSzp^rm 6F}ǵ}͹TUۭ0hD9JnrW=]|ClWwjaGhiO(2q7y28/kjf }-$r /k*њnt\]8#-<,}k6j֚K<*_q.?jIJP2J zs;HWoq֣T:}R$/w?BIZ;QV+#.+:Y\|n z 7W'Pzj: PB-H}N'.G(ti6ZϹ@yksZ/.r̵+ 5ˮAފ רEA S0Ru^Fh Xo& 2@1>tfX\ 451aо#uՅ٠7!SE*(S״u5;C}h .,b$qz\ I–|gkw7&TJgPz#<~_zvMK@_w_hÁAit⭷7יs )sRQ*ޝ`$bqvPNgc] }`LGxFκiO&Ӽ-ML-ݣD_~fwogi|w:lqg*wOSn]rf1mzwoɬGԺ:߳'=MO̺-bOO~< 5=6wa>O3{`N! __s=/9>/!vA7;OUi g57鞋;3Hzr|}op?+,L;k7˗oK-U}W=ڟcQwAqB <֝AjFM=>ok\ѺrzK,B9 rrFG>m/&/tO%)m)};Gm}%~uO}pW_-ҟn8[N_=qhSO ::{9Ҙ_m}VٞC}N>ަ_U ڌ}y!o}'wB][KߘwѿmGwD=}7`^aܔ)-7`lm4؎-}13z5IBن6XẊWO4j.m@ 糞Fφ@gS F lZ^zJ *@햇 lw<}6 {LFCOS=tFlt8[] 7իspg³C2V^ݎ`zgR&tmziߑVmRNXwK-9Y{#9V=,Gz#x6PyN尪By0:zR z0{yșd!ӄ5g<{sq-߀ML-#+ܱ1u\9J_@OINeP{wh",ҁ)J{3YOx&y H`齉qw#'q7Szҵ=Ӹ3vAZxws,EGy~ЄN zxd*؎߉gƻHqcZTD:HVA[g;?p{<x.SWA?D63==:<•_(_:*}-#ױ㔁 q~HoEՒ __ʊŹɻq޸?&\ߡLFo¯H=ZG0F"@)! H|$$#9LO)_4 9G_K <'KI/yB>'}2FCl}JoG|}9/eQѷ?G/DJ'1QߋɊe__VCeu+5Ǿ)O_͔~-+;`b(~Y3o V`I yYʴ_R@BRL0!%Mf a.o%9^h} obc7]ȥ)̔7 h'D}dʛ˻mrCGʏ*?]~|b-Nw瘟0L.!QbTaC3!3Cr)'L5SM:40 d=|D觅}>%>{'2Л ,.'+0dΌZf4jiVMԦhӵ,mV-j(uZEۡhZ6=՞Ljڳiy%U -ͬvN{_PsOHDY1 IҴfCtq%]fY P2tuٺ\]nDu*u5Y]=lԵwbH3mIX8择}#`A*?%%!URU~׉>wHu7cIjbUݱ.V"{b c I}:VC>[ObM&r< &Rd6B6Mc76UE,bl-k&bmPG)4{g/W;N=v]bgj)tu:K֨,=V ԅ}q=[H)H_B*l# d{lul5Q66D^DфXB*uJ"3dC^'" #*ĐT3R ]iȨ1l4ސ]h =k5䅞-\|iPh,vV: %krigQ2LȋX49O8x )_ QFȃX&C|.eC#\yyb~t-1(#=ʳFhb!ye;fY!I.rPO X9㋹Ȼ8ﲡvC^3tV4X+o!>G""^HkJr!Ob~,^I-f \a`1׽d/Iz/Xm9|Yd`UaJe_Wz=_S/Rޯ}#eET=y$/ E&ڢa\ˢ>5 =[5TEƤj\U]f\pMjU 76nWm1L J i]!;* dUaF㴾87[ b\{硽bHXB{csxmWū炌Չ"([B(wF+B_mau]HnG5!AڲFh⚈TW;'q f(9}@ߣ|(*}rAoP7(oP~]"w{E~Fߋ"QH7HߋDm =PʨSU-EeW>PyTAAaQ Uj0::Ҩ.*@[;9}C#fG܎;2T;6ޑ#oRUc玒ۯiTH&+@ov'#ζNH©,"?!w$;d% ;'?!E ZH-1X&ę<[ o %8g0xX5; 3ac&.!?ed3$9$B&[Ȼ$l%yp~(I.} OVJ6]M.]wo3mUmeJonaқfV}HSӭ1$kl+SޮBUWQZR<-ۈ=oi*i OrVkv"Uik&HM,m;.u6_k+uÈ`_hC#P~J{zI{F;vB;6i{u]~AM$%Rtl.]eiuUBW+4Z茺:YעP,:Σx&hoE}Gh4I^EԤj245ٚ\M&OF٩)p Z*w=ы4FMtRjN3ӜT@ч@u~ьii.DZ*DZBsYs mGsSssXh54ȿfC+Gmvz6Y})jNݠݤݬ{b7EżmYvYnY^R,YVK8\+,a!m-|4EeeeC[[fՑ2gW6\`P1(=Y6R6Vvwzke7nMmU͔͗=([|RcsveT&d>ZA,k] ZI}g N t!HG t iHg C y& MB4 HKWK%e(݁@z  )Go]rKT{O-4OJeHVxm.' 4"OH+%D Ǥ2|Ke#Ui5} -qnCyzJs!=C(_浲5T`>#"^_ 唿/\cLDY+r+y3^d[7_er9 im *[W/K`YRl"yx/|(@D x*`ƈVYOԕMcm[ b?|`3`Im< e*|t[];mx~%sV$i6X;r_@W/׍qq/vMB>"}XgYV%9y5uv|16զ{1W3qDa80gK prX?qo,LWuB =g'm̑7THD'1eyP+ ]Y,Ra': "mW0*[sOɿ0:I%"BNuG0#.ny[P/r_hݻ|],ϞX!N7u#edggfged+ !i?ogS /14MjVГj*?aR?["YOUR!VV֖F$S$VVOBV__}j}),ֹFz)_2䞒ܹdTɣ%K&m%SI%3Y hдAӒ wcIS̗mq5 } v7 |64&М4 >|5_fh7.?/lcNj+q}ط!GGHm;|cߠ_F>\/:&~7 _x;7svG}Q:&|p卦|mLq70?jyz5o75}ll<&GEj}_QϟW6>PzіXaubQdzucϺ% ze2ɬ>YY}MN~`RYܬaYwZߺ{ދa{[L~oʬZ(jaӿ:/>4^~ߣNR4[g@$7@ 3Mu]7ޥіF[4_~(Z{eߑ(~q|!s,3@l8k RV!veN$2eIzaqcQP|xyO%~a~a]_X_4W=94S?V2GOO,?dg}?gup[me 0yY:|}*E䜃9M}/_~?&7.Å_p8̕5Z>'ϥG2Q>R~5IO7,zz6==Gz0%:N!<*4|=30[yMkϴdzV׿g&[ @5qk-sW'}F{K[KK|,Y,%_u`?$FFb3Fߋq4jrO8o ,4o*h:ИNMzKtOWO UWOҖDyEyEyZ)"`fڤۉًS vyiҤ$JVKZ[n:̒, dт͜rr;^{`ܞw6@•)pI}(wLOΝ&|YLn_nD e"Dk)v˅)8(.]#>g;;s9SIdO4 S xTc&Ro&c>n1cOr_xRN7RS;S%"7I+F {g/?|Yodau,ߓO`z͘8-f6۫lwktg`}suv:o>/EWs2˿ +%g_)Y/2 RKdYkrL-7IVo9gqbs^Uy]Y.}C?ǂSJY ,ux7گ4pk7y N.._NZzmזRZ}W5OOu=9R^>g\jr-猈;`8gD9#v5sm1wV 3x-Z55Zg5%?YCyaeE'H^F5nz\[j]*6NV+eL>!d,7DRnfX.ryX){0BIYVFi-'⭦c[#cK M[ eXimͱطyk=*x'TgY\9vr#e{l:̍I'd'iOf))l-7F6mX:nu5[H, S.*0-i72BK1N ]cViEbd zZk)'[Aj/nmAӠ((蠙らAϮ4EmՋE[FKUZ-ȯ+{+ܙwcًOܕ>;%UQ[~| I-ie~Uw+\(gd/)M|[-:ƚ]x['j=-F;/h-װiDz_c ֈT=W=Rc5URU ghMWW&*mZq']S*#\'y\Z1[Ô+VggTmмn`!vJͪ&09 kD@j0O}þq=V;Z? W6`/evc`^VO  G0o`wHզ_[M)USZ ߡhS%jjF:}@=ncgMy !gislE٢UJGdz@<,U>`RK`f$8 GG8gz$1JQD;Kyiw%cp>-䝯8ZGm%aP5te#MỀH5f!CA2Mԅr#Z=Z3:#`fϿsa^%>-U`>S#&ѫD#,G Cb%a4VȥRqǓKg}fq|sy3&x~YP23'[HdiD7үǮ gkWzMZ͠3.Ҧڂv$DWtWLUMR Zk߰k˺1Ry-Kp`}_*z Ζ+T_',<l.Q^;E tֵw+cǡIs)/~h鶞Pg kʜI:=-r9+?"%jo9@32V Ub{FvUSyo]oZ{*{ktkUMuQ=I>$ bR(=jl el:Gg}r0%j `ul\e? Nr2 \$9|Se])M{EntM<:<Tv#D$iw Wk::}#\.+7^doj?v0^ 8Z|jO_``ղ3߳r\6w+|Cf,+cܫ(5${0+"{7>jYsP>&:lY1E{IqC\_H5v"}-r;G&fZ&*MH?ZD뮶W`%~{>DAuf/xV;(Cp F,CB+Gk)mzb+i nWtV1g)GMjWi8 pw7tơ;rr[0:kΐ^]Aͱ~YW>KE7G>y>W%}{ ~k;L'hFVyP |/\kAn&uzOS}3 g+ bbZW2kE(k:N,U{9gLyz-cVI9Jk\0f#k[,úE$t]gt$Q в 8ߝE&3#9G;m9:TGMYoXrwU)uʛ =jM+=5KQc\(I`=Ji?]NLUEiPQGNjad>4bTf~FRj!UzO*#QO{526 Uď M$#OGsnwH 3k;=0[@XN3Q?% Zɍ3Q!R?74GY O#F:^/A"G?D#D3|Ԩo ap8H+?ÌQ̦(&iD:avLx?ym>BQீs*LGp%y{@;4tmߪk3frOGwNE~[n!q7(!~mp, t(vR#wk6֐"?A (%<ARW0gb9 h|C)wS$mrXLv{0w;IKE x%gCCg; qd@V[N4L'}+H}͛&ehVy%x7My>ޥh;\p>]+~ӧr>+0n5;wUS#_]v\Z 4~(:u4ձ? .{$t7Jp0~y7X8wN\ SG·'m$*`}e}*t"oE>OGtDޫh0+c$wxZ~+r}7셷PrPe Ύ|iKj{f?"2+=)}OG":W"W ? ~\?Q?zgՇٍ0K' ϩm Df邷}]pn)ס QMS)KNݔUJ["Uxx.:#Ki`yzrF9oso4lg?5ǹVH[SE4-]Yt}Z#[׾}ؙ \[j:} ++Ap⳦z{Wsgu/%+"S5nդ~M?d= o5VF%o )̸.'5=v#ONYgo2[N.Tg_yY.!}z&H#{O(w1_zIdE}qAOuY\G}o*^3~A魴Wx\y?5I/3wG:ѯgUR}MNY_Sb,㥫Lb2d(R1f.W15[=`3I)eMXrZrQqHǂ4qlBW?QꪠLNj\`O&{_ě<u#W{TP-GJ,?wȿ,^z.Zrm'&ׂS]!8IQΘ0ҕiNCŰ 3.:|@1y#z&*!kTQ=^ g(Ku2ϧ[tRJk•Gy))+ʙBmxx'OfO(Sbln ٥ [*jo)pB/~GÓGy3:ۉa;jw: tQ/Y< q\g1[a Cps͔KGֽKs35ѕڽ|5R <k1Xx'uY^DVj3xbެeִikvǨ5qrPIo_,Q=X8/ҡo@g|cs6SJoF+:Uk8] ]e]#+*&*& k#zbrsp=f6smH^ɏ)3ΤyD}KcZhp6YVD~{q&1NE~mhzع&"te)#e܍2S(wA?zANī)zK yRkMk} zvY>Zܨr}.5V"GwK,l_Ľx&N[˞|Ʒ/_Dj^{BLs4*ϊy_$y7ȫby c8]OMZ>ܿNُNo)|F<>v`0`Dcy]ɛvu˗짚 NMuoR=vʄ.ߞ|r4yĨ?hA^(Ǧ2=GM'm]M?@Z`;N??*p#XnKyDz]+/5GC^7,,K7g(di^qir۽.}~GM`veMjf29$S/:RR7i'xM1ӿ˾ Uoۅ Ns{mw 4#1$p8Wy},_;P\wuFQlm.p]{5#%3 ϲqHb<ÛX]50r8SS1dMii.4eb^jF&f d3{^~tz]FГF߱D5e/cTt3]xrAtYRد_~-EE]t2oJVPң"2j L[s`UJO 6fnfJмfVf0{sTGBc/&$~ͱ"++8GpX±"*ǹ8V&^7ߐ_279M,XX!kh8'cE-sk8V&~+so˯J~ZqXDZ2{ѮFD/cF~/&ލ#!{qd6Ƒy_y1)q\6q0˖8"#Ql# Gd{qDGdgOȮ8"#;gqD?$3،NmΔa-)LIgJښ)c%vtUr> =HWXGmx=юGx3ѧve_dr~O*x_-8$o[\?/m4Ng/l¯0J%SٟoboYڱ֪Ug%a?[l}*3im"C[杶eq7TS(6^7ח?i#YW/gH2HX_#ɹ\_<3_rj Zmm^? ^S5ռ`w&-l {}Q;Ύ$fgl}VJ;.kv]iصvh7ۏ6Sl{>5u"w]pWtW-6w qwO݃a{̍u I~qpϺ_[~% ܭvounw[Vr{>wvGCa2L0iwsyaMxAxIxixyxsxk;3/g~” S٩T~^a0U*I5MMLN]j*KOuL]ꕺ#/_ReVmci3Ʒg۳ c#m67ζLhI&>l6ɱcXM gOZvbjg3$}__:Ivk9k皓K%S. L}4W)v]j 4oٷL}Ǿc;*d_5SM(sg9I@# #ꊊEe b€⪈ _Oܽ}{9O=U=5=ݿU:Pna2P:ua]Td>u h`}X~ `@{:Th]* @B[`=0:6tݡ;0CL` 038Np& ,`0+De.ւgȅ\` a6<`EALy2 8|\Jp5p<up7 n'7/nނ'np' `1, @D+`L5zXBxR&f,y/K`&l ^,xT\(xѰv>8@< !GH / p BHÙ88%qI0g,ep0O<.p\djk µ@.yX8 Ƹ1X` n[<<KqG,0x V\ V2k`YV325u k H@P@"`1$@HR'b1 l$ yPH(`N̈́& .(" C0"6Œ0 + ;p".pń' v/D (!BPJ f2"{h"D;5bMm%cN+jcCP`kA0Y0&3a\K^3<QuIx6xIނgp~i8EqX/¥0e|2 4`0u"8"dɄ"Jl„ l…BxTbNDD*]lFGNÐ]Y GBFAEb"/K㐗Đđ$$#/& /I!/I#/ /MD^$4IIIIF FFFF FFFF FFFFFyyyD`#pL̐̑,,ll\\ܐܑ x x"x!x# "Q#E@,"So(bvbv:bvb6 1@BF"fшi,4q8M@&"NɈi*4 q8@Flrx}20L#1c ۈmvb|lVc v]ڰ;}!փ=F3/(6PlRlzC8N0D g, 2հ<Uz >K83Nq\ÞBo\Sܔ2 &B@L$%B0 8)aI+AD01IDqD-JFGcģ) hx@*s20#x!*=^zlO3hn+Q ̈g$0+G@Om"yN{8ϓ*4IPW B@F⢺8Ai ~ Oi+UX"я/sM o+!tƘ+OzyDA9aCņWIH,1:NgQhƶo-@;lL"Ħ2p}j EJ *,ѐ9 iil RL( IMOa+rQwb47}Nz\S:7#HCTXX@*ȌcF3IsLSUc{̫8)Xd1}ؚתBSbFB,W9E%I߈t07cIկH(0Kh*c0 GT(GDzBU[ڎ\2V<9,r?-cww^pҞ#yh/h3ׄL3xË_]7Uyd;3=$R }j8ɺ(la~VeO.)0*]?>vâsԟ9t2~_㊒~wl\҂ ݻw,YkaYO6 #W 4RX}/ y/<Żp waDK5zK*{Nh"yCl*wfɐ 7)d61=??=/seLW9u&*)9SV/w\aܻؔ:1_AGi?]g{ S]wSe7 `oobEմ{y*2S+FA_ZAb+CE Y:Fl ]82ʌcdoiiJULIqdӋ7Ci-fFǼ*_KR S wH2TGFl}&QIIpm=3;v{[~ls.~93iV Jv2..]fvx&>`{UWZR[,T Ǎz7~r5Ֆg I3_&,v}yua㝧 w$$hҋ$U{#Gmϐϧ/%,pSnggidwM}2tnֳ)w;.K@AbAc,NRRc1d 'k/: L]Zݗn_9'fV1e/"Jݩ3}v~[(Wz/(])/v2w*g ƉފqXyÆ՞!wx(_غ!x@:{xrݛ}ޭ-Uυ7s7N!NU*_䯔=y(7:ع賲tgÈ7w8ilf%/;uAWB,vݶ{åkĚoz=OѣzWk9[&HGtOYY,0|uy|lh^JxEFYƐ ݱ#e2pƿI*0U[! MU׶2r1o~T\]\)i_3ڵk,Y>5/|s-a+vu<.M*f?iMPy^fij7١|p\WI@~KՠKՎlMpcnhM;XvʖŸlI_wl閨7}ֆB[:[7iFMH`FU*զ]콻$FNv?jWuc{UeJ}B6KM4qa]tG[_xHmŮ7rzSVrZ5b{Vk382JGƷkw ɿX@2wjу}HڰL[14~E`  L wٰxIjjU5Mtg5XtU~I^l̉ A vB {G_~+cSJWܦ'΋(ݡmϕjQHUbklu{ޯ͹2t%j>>!{K Ej#ͣKQM(*eߑı! k [,ۜmnDC~ᩅW4nll؟Ţ+OĊ[DΥƅk˔0̆ wyoǖ+:ŧZ5"3">y':P~mJїܔ@ŏJŒ7\ &}|ʺ{ހشY,f˜em<9E333FE010C34342B0B195BB0053EEBD>] /Filter/FlateDecode/Length 319>> stream x5ѻJAKwMv7d#6F 76b B,|QRP06 b#:| ÙGp5JBHP`mE Hx69p; |o<3HW@fd96v$}kVA Q6SOW1H{w z{y _{4$I@`8Ċ8 +0aEI$%QFD'(VFH; C\$I4ɐ,ɑ<#8uٕ(_$۠> K7NS+D endstream endobj xref 0 106 0000000052 65535 f 0000000017 00000 n 0000000125 00000 n 0000000237 00000 n 0000000513 00000 n 0000003719 00000 n 0000003854 00000 n 0000003882 00000 n 0000004044 00000 n 0000004117 00000 n 0000004362 00000 n 0000004537 00000 n 0000004783 00000 n 0000004952 00000 n 0000005193 00000 n 0000005331 00000 n 0000005361 00000 n 0000005527 00000 n 0000005601 00000 n 0000005858 00000 n 0000006034 00000 n 0000006273 00000 n 0000006535 00000 n 0000006776 00000 n 0000036721 00000 n 0000070085 00000 n 0000070347 00000 n 0000070588 00000 n 0000113954 00000 n 0000151174 00000 n 0000151436 00000 n 0000151677 00000 n 0000194067 00000 n 0000223201 00000 n 0000223463 00000 n 0000223704 00000 n 0000257926 00000 n 0000299556 00000 n 0000299803 00000 n 0000300017 00000 n 0000325750 00000 n 0000326012 00000 n 0000326253 00000 n 0000362557 00000 n 0000402435 00000 n 0000402697 00000 n 0000402938 00000 n 0000437826 00000 n 0000467912 00000 n 0000468188 00000 n 0000468476 00000 n 0000503049 00000 n 0000000053 65535 f 0000000054 65535 f 0000000055 65535 f 0000000056 65535 f 0000000057 65535 f 0000000058 65535 f 0000000059 65535 f 0000000060 65535 f 0000000061 65535 f 0000000062 65535 f 0000000063 65535 f 0000000064 65535 f 0000000065 65535 f 0000000066 65535 f 0000000067 65535 f 0000000068 65535 f 0000000069 65535 f 0000000070 65535 f 0000000071 65535 f 0000000072 65535 f 0000000073 65535 f 0000000074 65535 f 0000000075 65535 f 0000000076 65535 f 0000000077 65535 f 0000000078 65535 f 0000000079 65535 f 0000000080 65535 f 0000000081 65535 f 0000000082 65535 f 0000000083 65535 f 0000000084 65535 f 0000000085 65535 f 0000000086 65535 f 0000000087 65535 f 0000000088 65535 f 0000000089 65535 f 0000000090 65535 f 0000000091 65535 f 0000000092 65535 f 0000000093 65535 f 0000000094 65535 f 0000000000 65535 f 0000504850 00000 n 0000505289 00000 n 0000607079 00000 n 0000607403 00000 n 0000607600 00000 n 0000607627 00000 n 0000646475 00000 n 0000646979 00000 n 0000711955 00000 n 0000712369 00000 n 0000712601 00000 n trailer <<9E333FE010C34342B0B195BB0053EEBD>] >> startxref 713123 %%EOF xref 0 0 trailer <<9E333FE010C34342B0B195BB0053EEBD>] /Prev 713123/XRefStm 712601>> startxref 715403 %%EOF